HomeLarge Type Edition
HOME ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Services
Right arrow Download to citation manager
PubMed
Right arrow PubMed Citation
The Journals of Gerontology Series A: Biological Sciences and Medical Sciences 62:343-349 (2007)
© 2007 The Gerontological Society of America

Liver X Receptor Alpha Associates With Human Life Span

Simon P. Mooijaart, Maris Kuningas, Rudi G. J. Westendorp, Jeanine J. Houwing-Duistermaat, P. Eline Slagboom, Patrick C. N. Rensen and Diana van Heemst

1 Department of Gerontology and Geriatrics, 2 Department of Medical Statistics and Bioinformatics, 3 Section of Molecular Epidemiology, and 4 Department of General Internal Medicine, Endocrinology and Metabolic Diseases, Leiden University Medical Center, Leiden, The Netherlands.
5 Department of Biotechnology, Institute of Molecular and Cell Biology, Tartu University, Tartu, Estonia.

Address correspondence to Simon P. Mooijaart, MD, Department of Gerontology and Geriatrics, C-2-R Leiden University Medical Center, PO Box 9600, 2300 RC, Leiden, The Netherlands. E-mail: s.p.mooijaart{at}lumc.nl


   Abstract
Top
 Abstract
Methods
 Results
 Discussion
 References
 
In the nematode Caenorhabditis elegans, nuclear hormone receptor DAF-12 regulates the decision to go into a resistant dauer diapause, in which the worm exhibits a decreased rate of aging. Using sequence similarity searches, we previously identified the liver X receptor alpha (LXR{alpha}) as one of the human nuclear hormone receptors the protein sequence of which is most similar to C. elegans DAF-12. Here, we studied whether variation in the gene encoding LXR{alpha} associates with human life span. In the Leiden 85-Plus Study, a population-based prospective follow-up study, we genotyped four polymorphisms spanning the gene coding for LXR{alpha} (NR1H3) and tagged four common haplotypes. Among 563 participants, haplotype 2 associated with reduced mortality during the 7-year follow-up (hazard ratio 0.78; p =.015), predominantly caused by reduced mortality from infectious disease (hazard ratio 0.31; p =.023). Haplotype 2 also associated with higher levels of plasma apolipoprotein E, a target gene of the LXR{alpha} (p =.018), and higher levels of triglycerides (p =.041). Genetic variation in the gene coding for the LXR{alpha} (NR1H3) associates with human life span.

Human life span is under genetic control (1,2), but only few specific genes modulating life span have been identified. In the nematode worm Caenorhabditis elegans, DAF-12 is a nuclear hormone receptor (NHR) that in response to environmental cues regulates the entry into dauer diapause (3). Under adverse environmental conditions, unliganded DAF-12 coordinately turns down essential traits—such as metabolism, feeding, and reproduction—making the worm more stress resistant and extending larval survival up to 5-fold (4), which suggests that during the diapause the worm ages at a lower rate. Genetic mutations in daf-12 can be either dauer defective or dauer constitutive (5) and, in parallel, can decrease or increase adult life span of C. elegans (6). Using sequence similarity searches, we previously identified the liver X receptor alpha (LXR{alpha}) as one of the human NHRs the protein sequence of which is most similar to C. elegans DAF-12 (7). However, nothing is known about the association of genetic variants in the gene coding for the LXR{alpha} (NR1H3) with human life span.

In humans, the LXR{alpha} is expressed in the liver, kidney, macrophages, astrocytes, and other tissues (8). Oxysterols are breakdown products of cholesterol and serve as ligands for the LXR{alpha} (9). Binding of ligands leads to the transcription of target genes that coordinately regulate various processes that together result in increased catabolism and excretion of cholesterol from the body (10,11). In humans, cholesterol is a major determinant of mortality in old age, especially from infectious disease (12).The LXR{alpha} is also involved in innate immunity, as activation of human macrophages that produce cytokines is dependent on LXR{alpha} (13). In humans, cytokine production is a highly heritable characteristic (14) and associates with diseases and mortality up to the highest age category (15). These observations make the LXR{alpha} a candidate to affect human life span.

To test the hypothesis that the LXR{alpha} is involved in modulating human life span, we made use of genetic variation in the gene coding for the LXR{alpha} (NR1H3). Out of the data that recently came available from the HapMap Project, we selected four evenly spaced haplotype-tagging single nucleotide polymorphisms (SNPs) spanning the NR1H3 gene. In the Leiden 85-Plus Study, a prospective population-based follow-up study of 563 elderly persons aged 85 years or older and onwards, we studied the association of the common haplotypes with survival during a mean follow-up period of almost 5 years. To further explore a potential role of the LXR{alpha} in biological mechanisms associated with modulation of human life span, we associated the genetic variation to mortality-related phenotypic markers.


   METHODS
Top
 Abstract
 Methods
Results
 Discussion
 References
 
Study Population
The Leiden 85-Plus Study is a prospective population-based study in which inhabitants of Leiden, The Netherlands, aged 85 years, were invited to take part. There were no selection criteria related to health or demographic characteristics. The study population consists of 599 individuals (all members of the 1912–1914 birth cohort) who were enrolled in the month of their 85th birthday between 1997 and 1999 (16). DNA was available for 563 people. The Medical Ethical Committee of the Leiden University Medical Center approved the study, and written informed consent was obtained from all participants.

Causes of Death
All participants in the Leiden 85-Plus Study were followed for mortality until August 1, 2005. Primary causes of death were obtained from death certificates registered at the Dutch Central Bureau of Statistics and categorized according to the 10th International Classification of Diseases (ICD). Specific causes of death were categorized into cardiovascular disease (ICD codes I00–I99), infectious disease (ICD codes A00–B99 or J11–J18), cancer (ICD codes C00–D48), or other causes (all other ICD codes).

Plasma Measurements
At baseline, participants were visited twice at their place of residence within 1 month after their 85th birthday. All blood samples were collected early in the morning, but fasting was not required.

Plasma levels of total cholesterol, high-density lipoprotein (HDL) cholesterol, triglycerides, and C-reactive protein (CRP) were analyzed on fully automated computerized analyzers (Hitachi 747 and 911; Hitachi, Ltd, Tokyo, Japan). The level of low-density lipoprotein (LDL) cholesterol was estimated by the Friedewald equation (LDL cholesterol [mmol/L] = total cholesterol – HDL cholesterol – [triglycerides/2.2]), whereby participants with a triglyceride concentration higher than 443 mg/dL (5 mmol/L) were excluded (n = 5).

Apolipoprotein E (ApoE) levels were determined in 2005 in one batch of plasma samples that were collected at age 85 years at study baseline and stored frozen. Plasma ApoE levels were determined using a human ApoE-specific sandwich enzyme-linked immunosorbent assay (ELISA) essentially as described (17). The detailed procedure is described in (18).

Cytokine Production Capacity of the Innate Immune System
The cytokine production capacity of the innate immune system was assessed by stimulating ex vivo whole-blood samples with lipopolysaccharide (LPS) as described elsewhere (19). In short, all venous blood samples were drawn in the morning before 11 AM to exclude circadian variation, diluted 2-fold with RPMI-1640, and stimulated with Escherichia coli–derived LPS (10 ng/mL; Difco Laboratories, Detroit, MI). After 4 hours and after 24 hours of incubation at 37°C and 5% CO2, supernatants were collected and stored at –80°C to measure tumor necrosis factor-alpha (TNF-{alpha}), interleukin-1 beta (IL-1ß), IL-6, IL-10, IL-12, IL-1 receptor antagonist (IL-1Ra), and interferon-gamma (IFN-{gamma}), respectively. Standard ELISA techniques were performed according to the manufacturer's guidelines (Central Laboratory of the Blood Transfusion Service, Amsterdam, The Netherlands). Because of a possible distortion by frailty (20), we restricted these analyses to those participants who survived for at least 2 years (n = 463).

SNP Selection and Genotyping
Four SNPs in the NR1H3 gene were selected using the HapMap database (http://www.hapmap.org; version June 2005). Only validated SNPs were selected, and calculations on linkage disequilibrium (LD) and frequencies were performed using data from the European Centre d'Etude du Polymorphisme Humain (CEPH) population. As boundaries, the first SNP upstream of the ATG start site (LXR{alpha}5 untranslated region [UTR], rs11039149) and the first SNP downstream of the stop codon (LXR{alpha}3UTR, rs1449627) were selected. The expected D' between these two SNPs was 1, indicating that the entire region is in strong LD. We additionally selected one SNP in exon 3 (LXR{alpha}ex3, rs227923) and one in intron 6 (LXR{alpha}int6, rs712011), resulting in a set of four evenly spaced SNPs, separated by 5 kb.

Genotyping
The polymorphisms were genotyped using either an Assay-by-Design or an Assay-on-Demand (Applied Biosystems, Nieuwerkerk aan den IJssel, The Netherlands), consisting of PCR primers and TaqMan Major Groove Binding (MGB) probes. For LXR{alpha}5UTR an Assay-by-Design was used with forward primer GAGCATCTGCAGGGTTCTCA, reverse primer GCCAGTGAAGTGCTGTAATGGAA, one probe CCCCTGTFormulaGCCCACC labeled with VIC, and one probe CCCTGTFormulaGCCCACC labeled with FAM. For the LXR{alpha}ex3 SNP an Assay-on-Demand was used with identification number C__15967384_10. For LXR{alpha}int6 an Assay-on-Demand was used with identification number C___1301060_20. For LXR{alpha}3UTR, an Assay-by-Design was used with forward primer CCTCACGTGCATGTGTAGCAT, reverse primer AGGTCTTTCAGGTTGTGCCTTTT, one probe CCTTGGFormulaTTTTCC labeled with VIC, and one probe CCTTGGFormulaTTTTCC labeled with FAM. Amplification reactions were performed at standard conditions except for the following modifications. A qPCR core kit was used (Eurogentec, Maastricht, The Netherlands) with half of the amount of primers and probes. Real-time PCR was performed on an ABI 7900 HT (Applied Biosystems), and genotypes were called using the Sequence Detection System 2.1 (Applied Biosystems). A random 10% of all genotypes were performed in duplicate, and genotyping errors were <2% for all assays.

Statistical Analysis
The program Haploview (21) was used to estimate allele frequencies, test the consistency of genotype frequencies at each SNP locus with Hardy–Weinberg equilibrium, and estimate and plot pairwise LD between the SNPs examined. LD was estimated for all two-way comparisons of individual SNPs using two common measures: the r2 (the square of the standardized correlation coefficient) and the Lewontin D' (D' = D/Dmax if D > 0 or D' = D/Dmin if D < 0). Haplotypes and haplotype frequencies were estimated using the SNPHAP software (http://www-gene.cimr.cam.ac.uk/clayton/software/). The posterior probabilities of pairs of haplotypes per subject as estimated by SNPHAP, were used as weights in the following analyses.

Continuous variables were normally distributed, except for plasma ApoE levels, triglycerides, CRP levels, and cytokines, which therefore were ln-transformed. All analyses were sex adjusted, using homozygosity for the most common haplotype as the referent group. Associations between haplotypes and metabolic profile were analyzed using linear regression. Mortality risks and 95% confidence intervals (CI) were calculated with the Cox proportional hazard model. These analyses included all the estimated haplotypes in the model weighted for probability, except the reference haplotype. Clustered robust standard errors were calculated using individuals as clustering variable. These models assume an additive effect of the haplotypes. Haplotypes with low frequencies (<5%) fully participated in these analyses, but results on these haplotypes are not reported as their accuracy is low due to small numbers. The analyses were performed using STATA statistical software, version 9.0 (STATA Corp., College Station, TX).


   RESULTS
Top
 Abstract
 Methods
 Results
Discussion
 References
 
The baseline characteristics of the study populations are listed in Table 1. All participants were aged 85 years, and 67% were female.


View this table:
[in this window]
[in a new window]

  		Table 1. Baseline Characteristics of the Study Population.

 
The position of the selected SNPs relative to the gene structure is shown in Figure 1A. The SNPs were in strong LD (D' > 0.97) and constituted one haplotype block (Figure 1B) with seven haplotypes, of which the predicted frequencies are listed in Table 2. For the present analyses we report the results of the four most common haplotypes (frequency > 5%) that cumulatively account for >97% of the haplotypes.


Figure 01
View larger version (18K):
[in this window]
[in a new window]

  		Figure 1. Haplotype structure of the NR1H3 gene in the Leiden 85-Plus Study population. (A) Relative position of the selected single nucleotide polymorphisms (SNPs) in the NR1H3 gene. Vertical bars: exons 1–9. Arrows: positions of SNPs. (B) Visual representation of linkage disequilibrium within the gene. Based on standard confidence interval criteria, all four SNPs constitute one haplotype block. Top triangles (pointing upwards, all black) indicate strong linkage disequilibrium of all four SNPs. Pairwise linkage disequilibrium is indicated by the numbers in the top triangles. Pairwise R2 values are indicated by the numbers in the bottom triangles (pointing downwards), in which light gray triangles indicate low R2, and dark gray triangles indicate high R2

 

View this table:
[in this window]
[in a new window]

  		Table 2. Haplotype Structures and Frequencies.

 
During a mean follow-up time of 4.9 years, 320 participants (57%) had died. We compared the mortality risk associated with the various haplotypes, using the most common haplotype 1 as the reference category (Figure 2). The mortality risk was lower for haplotype 2 compared to haplotype 1 (hazard ratio [HR] = 0.78; 95% CI, 0.64–0.95; p =.015), whereas other haplotypes were not significantly associated with a higher or lower mortality risk.


Figure 02
View larger version (8K):
[in this window]
[in a new window]

  		Figure 2. Dots represent hazard ratios calculated using a Cox proportional model adjusting for gender; bars represent 95% confidence interval. Mean follow-up time was 4.9 years, in which time a total number of 320 participants (57%) died

 
When assessing specific causes of death, the lower mortality risk that was associated with haplotype 2 was mainly caused by a lower mortality risk from infectious disease (HR = 0.31, 95% CI, 0.12–0.85; p =.023) and from mortality in the category "other causes" (HR = 0.71, 95% CI, 0.50–1.00; p =.052).

The relationship between the four common haplotypes and variables in lipid metabolism is shown in Table 3. Haplotype 2 associated with significantly higher plasma ApoE levels (+0.48 mg/dL, p =.018) and triglyceride levels (+0.098 mmol/dL, p =.041) compared to haplotype 1. Haplotype 4 also associated with higher plasma ApoE levels compared to haplotype 1, although the association was borderline statistically significant (+0.45 mg/dL, p =.057), possibly due to the lower haplotype frequency.


View this table:
[in this window]
[in a new window]

  		Table 3. Association of NR1H3 Haplotypes With Parameters of Lipid Metabolism.

 
To explore the association of NR1H3 haplotypes with innate immune function, we assessed cytokine production capacity by ex vivo whole-blood LPS-stimulated cytokine levels (Table 4). We found no association of any haplotype with cytokine production capacity. Finally, to investigate the possibility that the LXR{alpha} regulates inflammation through alternative mechanisms, we associated the haplotypes with circulating CRP level, a plasma marker of systemic inflammation. We found no association for any haplotype with circulating levels of CRP (Table 4).


View this table:
[in this window]
[in a new window]

  		Table 4. Association of NR1H3 Haplotypes With Whole-Blood Lipopolysaccharide (LPS)-Stimulated Cytokine Levels at Baseline.

 

   DISCUSSION
Top
 Abstract
 Methods
 Results
 Discussion
References
 
In C. elegans, the NHR DAF-12 has been shown to be one of the key components that modulate life span in response to environmental cues. Based on protein sequence comparisons, we recently identified the LXR{alpha} as one of the human NHRs most similar to C. elegans DAF-12 (7). Here we report that genetic variation in the gene coding for the LXR{alpha} (NR1H3) associates with human life span.

We found that a common haplotype of the NR1H3 gene associated with life-span extension, predominantly attributable to decreased death from infectious disease. The LXR{alpha} is involved in various processes that contribute to infectious disease. The LXR{alpha} regulates specific processes that increase resistance to pathogens. For instance, LXR{alpha} regulates the expression of APa, a scavenging receptor that inhibits macrophage apoptosis and promotes the killing of the bacteria (22). Although LXR agonists reduce inflammatory gene expression in models of dermatitis and atherosclerosis (13), LXR{alpha}–/– knockout mice are more susceptible to infection with Listeria monocytogenes (22).

In the search for an intermediate phenotype, we associated genetic variation in the NR1H3 gene with mortality-related markers in lipid metabolism and immunity. We selected these markers because these phenotypes are known to associate with mortality and a functional relationship with the LXR{alpha} protein was plausible. Cholesterol metabolism is related to various causes of death (12), and the LXR{alpha} is involved in various components of lipid metabolism, such as reverse cholesterol transport, cholesterol excretion, and fatty acid synthesis (10). We observed an association of haplotype 2 of the NR1H3 gene with increased plasma ApoE and triglyceride levels. ApoE is a component of triglyceride-rich lipoproteins, such as very-low-density lipoprotein (VLDL), which may explain why haplotype 2 associates with plasma levels of both ApoE and triglycerides. Furthermore, LXR{alpha} agonists have been suggested for therapeutic use against cardiovascular disease, but a serious side effect of the use of LXR agonists as therapeutic agents is the concomitant increase in liver and serum triglycerides (23). These effects are caused by a strong induction of lipogenic genes in the liver and an increased VLDL production (23). In line with these animal data, we found that haplotype 2 also associated with higher ApoE levels. Thus, the associations with increased levels of triglycerides and ApoE presented here suggest that haplotype 2 associates with increased LXR{alpha} activity in the liver. It is interesting that triglyceride-rich lipoproteins (of which ApoE is a component) act as agents of the innate immune system (24), for example, by binding and neutralizing bacterial components. ApoE redirects lipopolysaccharides (bacterial components) in the liver from Kupffer cells to hepatocytes and protects against endotoxemia in rats (25). Recently, it was discovered that ApoE is also involved in lipid antigen presentation (26) and that high plasma ApoE levels associate with increased systemic inflammation (18).

LPS-stimulated cytokine production levels are highly heritable (14), and cytokine production profiles associate with patterns of old age mortality (15). However, genetic variation in the genes coding for the cytokines has so far been insufficient to explain the heritable component (27). In the present study, variation in the NR1H3 gene did not associate with ex vivo LPS-stimulated whole-blood cytokine levels or with circulating CRP levels. Others have demonstrated an association of the LXR{alpha} with inflammation in macrophage and monocyte cell cultures (13,28). However, inflammatory cytokines and other serum mediators were not different between LXR{alpha} and LXRß knockout mice and wild types (22). We interpret that NR1H3 may not be a major determinant of cytokine production capacity in blood upon stimulation by LPS. This interpretation does not, however, exclude the possibility that in other cell types NR1H3 haplotypes may influence the local production of cytokines.

We did not observe a beneficial effect of haplotype 2 on death from cardiovascular causes. In mouse models, LXR agonists reduce the formation of atherosclerotic lesions (29) whereas macrophage-specific LXR{alpha} knockout aggravates atherosclerosis development (30). To date, the function of the LXR{alpha} in lipid and cholesterol metabolism has been studied in mouse models and in human cultured cell lines, mostly macrophages. However, caution must be taken in extrapolating these results based on cultured cells and mouse models of atherosclerosis to humans (31). Whereas macrophage LXR has been shown to be antiatherogenic (30,32), this beneficial effect on cardiovascular disease may be balanced by proatherogenic effect of liver LXR activation.

Genetic variation in both C. elegans daf-12 and the human NR1H3 gene associates with differences in life span, suggesting that the two genes may, at least to some extent, be functionally conserved. Other evolutionarily conserved pathways have previously been implicated in life-span regulation. For example, it was first discovered that the C. elegans daf-2 mutant was long lived (33). Later it was discovered that the daf-2 gene shows homology to the mammalian genes encoding the insulin receptor (IR) and insulin-like growth factor 1 receptor (IGF-1R) (34), which are conserved throughout evolution. Extended life span was then also demonstrated in IR mutants in Drosophila melanogaster (35) and in IR and IGF-1R mutants in mice (36,37). Recently we showed that reduced insulin signalling in humans also associates with longevity (38). These observations suggest that the approach of studying evolutionarily conserved pathways is fruitful in identifying genes that regulate human life span.

Very recently, several articles report on the biological function of daf-12 in C. elegans. Two hormones were identified that function as DAF-12 ligands (39), and the biosynthetic pathway of production of these ligands was described in more detail (40). Furthermore, cholestenoic acid was found to rescue the worm from dauer diapause in a DAF-12–dependent manner (41). These studies provide important new hints to investigate the functional conservation of life-span regulation throughout evolution and the biological function of the human LXRs or other NHRs.

A limitation of our study is that it does not include analyses of the gene encoding the LXRß (NR1H2). The LXR{alpha} and LXRß are highly similar proteins, as their amino acid sequences are very alike and the proteins have similar functions in lipid metabolism and inflammation. It could therefore be hypothesized that a loss of function of one of the genes will be compensated for by the function of the other receptor and will therefore not have dramatic effects. The LXR{alpha} and LXRß are encoded by different genes and have different expression patterns. Whereas the LXR{alpha} is expressed only in a limited number of tissues, the LXRß is expressed ubiquitously. Indeed, in activated macrophages the inhibiting effect of LXR ligands on cytokine expression is completely abrogated in double knockout macrophages (nr1h3–/– nr1h2–/–). However, there was also a partial reduction of this effect in nr1h3–/– macrophages (13). Furthermore, whereas LXR{alpha}–/– knockout increases susceptibility to bacterial infection, additional knockout of LXRß does not increase this susceptibility (42). These observations suggest that genetic variation in LXR{alpha} may have functional significance independent of LXRß. A second limitation is that it is unclear which genetic variant within the haplotype is responsible for the observed functional variation. The SNP that tags haplotype 2 is located in the 5' UTR of the gene. It is, however, unknown whether this SNP itself has functional significance—for instance, by affecting promoter function or interaction domains. Alternatively, the 5' UTR SNP may be in LD with an SNP elsewhere in the genome, for instance in the coding region of the gene, which leads to an alteration with functional significance.

The strong point of our study is that we selected genetic variants tagging all common haplotypes of the NR1H3 gene and associated them with a range of variables in inflammation and lipid metabolism. Furthermore, the prospective nature of the mortality analyses and the relatively large number of deaths yield a powerful tool to study mortality risk.

As this is the first report on the effect of common genetic variants in the human NR1H3 gene on human life span, the results of our observational study need further replication. Furthermore, more research is warranted to confirm which specific genetic variation on the haplotypes actually changes the function of the gene or protein.


   Acknowledgments
Top
 Abstract
 Methods
 Results
 Discussion
 References
 
This work was funded by an IOP (Innovative Oriented Research) grant (IGE01014) from the Dutch Ministry of Economic Affairs.

We thank Dennis Kremer for technical assistance.


   Footnotes
Top
 Abstract
 Methods
 Results
 Discussion
 References
 
Decision Editor: LaDora Thompson, PhD

Received May 13, 2006

Accepted November 6, 2006


   References
Top
 Abstract
 Methods
 Results
 Discussion
 References
 

  1. Hjelmborg JV, Iachine I, Skytthe A, et al. Genetic influence on human lifespan and longevity. Hum Genet. 2006;119:312-321.[Medline]
  2. Schoenmaker M, de Craen AJ, de Meijer PH, et al. Evidence of genetic enrichment for exceptional survival using a family approach: the Leiden Longevity Study. Eur J Hum Genet. 2006;14:79-84.[Medline]
  3. Antebi A, Culotti JG, Hedgecock EM. Daf-12 regulates developmental age and the dauer alternative in Caenorhabditis elegans. Development. 1998;125:1191-1205.[Abstract]
  4. Klass M, Hirsh D. Non-ageing developmental variant of Caenorhabditis elegans. Nature. 1976;260:523-525.[Medline]
  5. Antebi A, Yeh WH, Tait D, Hedgecock EM, Riddle DL. Daf-12 encodes a nuclear receptor that regulates the dauer diapause and developmental age in C. elegans. Genes Dev. 2000;14:1512-1527.[Abstract/Free Full Text]
  6. Fisher AL, Lithgow GJ. The nuclear hormone receptor DAF-12 has opposing effects on Caenorhabditis elegans lifespan and regulates genes repressed in multiple long-lived worms. Aging Cell. 2006;5:127-138.[Medline]
  7. Mooijaart SP, Brandt BW, Baldal EA, et al. C. elegans DAF-12, nuclear hormone receptors and human longevity and disease at old age. Ageing Res Rev. 2005;4:351-371.[Medline]
  8. Peet DJ, Turley SD, Ma W, et al. Cholesterol and bile acid metabolism are impaired in mice lacking the nuclear oxysterol receptor LXR alpha. Cell. 1998;93:693-704.[Medline]
  9. Janowski BA, Grogan MJ, Jones SA, et al. Structural requirements of ligands for the oxysterol liver X receptors LXRalpha and LXRbeta. Proc Natl Acad Sci U S A. 1999;96:266-271.[Abstract/Free Full Text]
  10. Lu TT, Repa JJ, Mangelsdorf DJ. Orphan nuclear receptors as ELiXiRs and FiXeRs of sterol metabolism. J Biol Chem. 2001;276:37735-37738.[Free Full Text]
  11. Repa JJ, Turley SD, Lobaccaro JA, et al. Regulation of absorption and ABC1-mediated efflux of cholesterol by RXR heterodimers. Science. 2000;289:1524-1529.[Abstract/Free Full Text]
  12. Weverling-Rijnsburger AW, Blauw GJ, Lagaay AM, Knook DL, Meinders AE, Westendorp RG. Total cholesterol and risk of mortality in the oldest old. Lancet. 1997;350:1119-1123.[Medline]
  13. Joseph SB, Castrillo A, Laffitte BA, Mangelsdorf DJ, Tontonoz P. Reciprocal regulation of inflammation and lipid metabolism by liver X receptors. Nat Med. 2003;9:213-219.[Medline]
  14. de Craen AJ, Posthuma D, Remarque EJ, van den Biggelaar AH, Westendorp RG, Boomsma DI. Heritability estimates of innate immunity: an extended twin study. Genes Immunol. 2005;6:167-170.
  15. van den Biggelaar AH, de Craen AJ, Gussekloo J, et al. Inflammation underlying cardiovascular mortality is a late consequence of evolutionary programming. FASEB J. 2004;18:1022-1024.[Abstract/Free Full Text]
  16. Bootsma van der Wiel A, van Exel E, de Craen AJ, Gussekloo J, Lagaay AM, Knook DL, Westendorp RG. A high response is not essential to prevent selection bias: results from the Leiden 85-Plus Study. J Clin Epidemiol. 2002;55:1119-1125.[Medline]
  17. van Vlijmen BJ, van den Maagdenberg AM, Gijbels MJ, et al. Diet-induced hyperlipoproteinemia and atherosclerosis in apolipoprotein E3-Leiden transgenic mice. J Clin Invest. 1994;93:1403-1410.[Medline]
  18. Mooijaart SP, Berbee JFP, van Heemst D, et al. ApoE plasma levels and risk of cardiovascular mortality in old age. PLoS Med. 2006;3:e176.[Medline]
  19. van der Linden MW, Huizinga TW, Stoeken DJ, Sturk A, Westendorp RG. Determination of tumour necrosis factor-alpha and interleukin-10 production in a whole blood stimulation system: assessment of laboratory error and individual variation. J Immunol Methods. 1998;218:63-71.[Medline]
  20. van den Biggelaar AH, Huizinga TW, de Craen AJ, et al. Impaired innate immunity predicts frailty in old age. The Leiden 85-Plus Study. Exp Gerontol. 2004;39:1407-1414.[Medline]
  21. Barrett JC, Fry B, Maller J, Daly MJ. Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics. 2005;21:263-265.[Abstract/Free Full Text]
  22. Joseph SB, Bradley MN, Castrillo A, et al. LXR-dependent gene expression is important for macrophage survival and the innate immune response. Cell. 2004;119:299-309.[Medline]
  23. Grefhorst A, Elzinga BM, Voshol PJ, et al. Stimulation of lipogenesis by pharmacological activation of the liver X receptor leads to production of large, triglyceride-rich very low density lipoprotein particles. J Biol Chem. 2002;277:34182-34190.[Abstract/Free Full Text]
  24. Barcia AM, Harris HW. Triglyceride-rich lipoproteins as agents of innate immunity. Clin Infect Dis. 2005;41:(Suppl 7): S498-S503.[Medline]
  25. Rensen PC, Oosten M, Bilt E, Eck M, Kuiper J, Berkel TJ. Human recombinant apolipoprotein E redirects lipopolysaccharide from Kupffer cells to liver parenchymal cells in rats in vivo. J Clin Invest. 1997;99:2438-2445.[Medline]
  26. van den Elzen P, Garg S, Leon L, et al. Apolipoprotein-mediated pathways of lipid antigen presentation. Nature. 2005;437:906-910.[Medline]
  27. Haukim N, Bidwell JL, Smith AJ, et al. Cytokine gene polymorphism in human disease: on-line databases, supplement 2. Genes Immunol. 2002;3:313-330.
  28. Landis MS, Patel HV, Capone JP. Oxysterol activators of liver X receptor and 9-cis-retinoic acid promote sequential steps in the synthesis and secretion of tumor necrosis factor-alpha from human monocytes. J Biol Chem. 2002;277:4713-4721.[Abstract/Free Full Text]
  29. Joseph SB, McKilligin E, Pei L, et al. Synthetic LXR ligand inhibits the development of atherosclerosis in mice. Proc Natl Acad Sci U S A. 2002;99:7604-7609.[Abstract/Free Full Text]
  30. Tangirala RK, Bischoff ED, Joseph SB, et al. Identification of macrophage liver X receptors as inhibitors of atherosclerosis. Proc Natl Acad Sci U S A. 2002;99:11896-11901.[Abstract/Free Full Text]
  31. Repa JJ, Mangelsdorf DJ. The liver X receptor gene team: potential new players in atherosclerosis. Nat Med. 2002;8:1243-1248.[Medline]
  32. Levin N, Bischoff ED, Daige CL, et al. Macrophage liver X receptor is required for antiatherogenic activity of LXR agonists. Arterioscler Thromb Vasc Biol. 2005;25:135-142.[Abstract/Free Full Text]
  33. Kenyon C, Chang J, Gensch E, Rudner A. Tabtiang RA C. elegans mutant that lives twice as long as wild type. Nature. 1993;366:461-464.[Medline]
  34. Kimura KD, Tissenbaum HA, Liu Y, Ruvkun G. Daf-2, an insulin receptor-like gene that regulates longevity and diapause in Caenorhabditis elegans. Science. 1997;277:942-946.[Abstract/Free Full Text]
  35. Tatar M, Kopelman A, Epstein D, Tu MP, Yin CM, Garofalo RS. A mutant Drosophila insulin receptor homolog that extends life-span and impairs neuroendocrine function. Science. 2001;292:107-110.[Abstract/Free Full Text]
  36. Bluher M, Kahn BB, Kahn CR. Extended longevity in mice lacking the insulin receptor in adipose tissue. Science. 2003;299:572-574.[Abstract/Free Full Text]
  37. Holzenberger M, Dupont J, Ducos B, et al. IGF-1 receptor regulates lifespan and resistance to oxidative stress in mice. Nature. 2003;421:182-187.[Medline]
  38. van Heemst D, Beekman M, Mooijaart SP, et al. Reduced insulin/IGF-1 signalling and human longevity. Aging Cell. 2005;4:79-85.[Medline]
  39. Motola DL, Cummins CL, Rottiers V, et al. Identification of ligands for DAF-12 that govern Dauer formation and reproduction in C. elegans. Cell. 2006;124:1209-1223.[Medline]
  40. Rottiers V, Motola DL, Gerisch B, et al. Hormonal control of C. elegans Dauer formation and life span by a Rieske-like oxygenase. Dev Cell. 2006;10:473-482.[Medline]
  41. Held JM, White MP, Fisher AL, Gibson BW, Lithgow GJ, Gill MS. DAF-12-dependent rescue of Dauer formation in Caenorhabditis elegans by (25S)-cholestenoic acid. Aging Cell. 2006;5:283-291.[Medline]
  42. Jonsson EG, Cichon S, Gustavsson JP, et al. Association between a promoter dopamine D2 receptor gene variant and the personality trait detachment. Biol Psychiatry. 2003;53:577-584.[Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Services
Right arrow Download to citation manager
PubMed
Right arrow PubMed Citation

HOME ARCHIVE SEARCH TABLE OF CONTENTS