HomeLarge Type Edition
HOME ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Services
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
PubMed
Right arrow PubMed Citation
The Journals of Gerontology Series A: Biological Sciences and Medical Sciences 62:18-26 (2007)
© 2007 The Gerontological Society of America

Effects of Caloric Restriction and Growth Hormone Resistance on Insulin-Related Intermediates in the Skeletal Muscle

Khalid A. Al-Regaiey, Michal M. Masternak, Michael S. Bonkowski, Jacob A. Panici, John J. Kopchick and Andrzej Bartke

Departments of 1 Internal Medicine, 2 Physiology, 3 Pharmacology, and 4 Microbiology and Molecular Biology, Southern Illinois University, School of Medicine, Springfield.
5 Edison Biotechnology Institute, Ohio University College of Osteopathic Medicine, Athens.

Address correspondence to Khalid A. Al-Regaiey, DVM, PhD, Department of Physiology, College of Medicine, King Saud University, Riyadh 11461, Saudi Arabia. E-mail: kalregai{at}gmail.com


   Abstract
Top
 Abstract
Materials and Methods
 Results
 Discussion
 References
 
Growth hormone receptor-deficient (GHRKO) mice are long-lived and have reduced insulin-like growth factor (IGF)-1 and insulin levels and enhanced insulin sensitivity thus resembling the phenotype of animals subjected to calorie restriction (CR). In contrast to its effects in normal mice, CR does not improve insulin sensitivity or increase longevity in GHRKO males. In an attempt to identify mechanisms underlying this differential response to CR, effects of CR on the expression of insulin-related genes were compared in GHRKO and normal mice. In addition to changes detected in both genotypes, and responses unique to GHRKO mice, the levels of Akt2 and peroxisome proliferator-activated receptor-{gamma} coactivator-1{alpha} (PGC1{alpha}) were increased and levels of phosphorylated c-Jun N-terminal kinase (JNK)1 were reduced in response to CR only in normal mice. These changes may be related to mechanisms of improving insulin sensitivity and life expectancy.

DISRUPTION of somatotropic (growth hormone [GH] and insulin-like growth factor [IGF]-1) signaling in mice by spontaneous or experimentally induced mutations leads to extended longevity. Mice with targeted disruption of the Ghr/GH bp gene (1) are GH receptor deficient, GH resistant, and remarkably long-lived (2). Phenotypic characteristics of these animals include reduced body size, reduced plasma IGF-1 and insulin levels, and enhanced sensitivity to insulin (1,3), thus resembling the characteristics of genetically normal mice subjected to caloric restriction (CR). However, microarray and real-time reverse transcription–polymerase chain reaction (RT–PCR) analysis of hepatic gene expression suggests that GHRKO mice are not CR mimetics (4–6), and it is unclear whether CR and GH receptor deletion affect longevity by similar mechanisms. To address this issue, we are comparing the effects of CR in GHRKO animals to its effects in normal mice. We have recently shown that, in contrast to improved insulin sensitivity and increased life span in normal animals subjected to CR, an identical CR regimen failed to enhance insulin sensitivity or increase average or mean life span of GHRKO mice and caused a small (but statistically significant) increase in the maximal life span only in females (7). We have previously shown that CR exerts differential effects on the expression of insulin-related genes in the liver of normal and GHRKO mice. While some of the effects of CR on the expression of the examined genes were detected in both genotypes, others were unique to either normal or GHRKO animals. The objective of the present study was to compare the effects of CR on the expression of insulin-related genes in the skeletal muscle of GHRKO and normal animals.

Skeletal muscle is a major target of insulin action, and insulin-stimulated glucose uptake by myocytes represents an important mechanism of the suppression of plasma glucose levels by insulin. We have previously reported that acute in vivo responses to insulin in the liver and the muscle are differentially affected by deficiency of anterior pituitary hormones, including GH, in another long-lived mouse mutant (8,9), and we have preliminary evidence that similar differences exist also in GHRKO mice (10) (Dominici FP, Bartke A, Turyn D, unpublished obsevrations, 2004).

We have proposed that enhanced insulin sensitivity is an important mechanism of life extension in GH-resistant and GH-deficient mice (7); therefore, we were particularly interested in identifying those alterations in the expression of insulin-related genes or in the levels of their products which were induced by CR in normal animals (in which CR was shown to improve insulin sensitivity and extend longevity) but not in GHRKO mice (in which insulin sensitivity and longevity were not affected by CR). Results of analyses of expression of insulin-related and IGF-1-related genes in hepatic tissue obtained from the same animals were reported previously (5,6,11).


   MATERIALS AND METHODS
Top
 Abstract
 Materials and Methods
Results
 Discussion
 References
 
Animals and CR
GHRKO mice (1) were derived from animals provided by Dr. J. Kopchick (Ohio University). Animals were produced by mating knockout (–/–) males with heterozygous (+/–) female carriers of the disrupted GHR/GHBP gene, and males were used for the current study. Animals were housed on a 12-h light/dark cycle at 22 ± 2°C and maintained as previously described (11). Starting at 2 months of age, normal and GHRKO mice were fed (Lab Diet Formula 5008; Ralston Purina Corp., St. Louis, MO) either ad libitum (AL) or submitted to CR in which they received (at 6:00 PM) daily rations corresponding to 70% of the food consumed by their AL counterparts (eight animals per phenotype per diet) as previously described (4). All animal procedures were approved by the Laboratory Animal Care and Use Committee at the Southern Illinois University School of Medicine.

At 21 months of age, the (nonfasted) animals were anesthetized with isoflurane, bled by cardiac puncture, and decapitated. Hind-limb skeletal muscles were rapidly removed, quickly frozen on dry ice, and stored at –80°C until processed.

Total RNA Extraction and Complementary DNA Transcription
Muscle samples were pulverized under liquid nitrogen by using a mortar and pestle. Total RNA was extracted from the skeletal muscle by the guanidinium thiocyanate–phenol–chloroform method (12). The RNA concentration was measured spectrophotometrically at 260 nm. One microgram of total RNA was subjected to electrophoresis on a 1.5% agarose gel to confirm RNA integrity. Potentially contaminating residual genomic DNA was eliminated using DNase I (Promega, Madison, WI). The complementary DNA (cDNA) was made using an iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA) as instructed by the manufacturer.

Real-Time RT–PCR
Real-time RT–PCR amplification was carried out with the iQ SYBR Green PCR Supermix (Bio-Rad) using the SmartCycler (Cepheid, Sunnyvale, CA). For most of the examined genes, the primers used for RT–PCR were reported previously (11). Protein kinase C (PKC){zeta} primers were: forward: aggtgcatcaactgcaagct, reverse: gttcttgccatctactggag; and for Foxo3, forward: tcaaggataagggcgacagca, reverse: tgttgctgttgtccatggag.

The real-time RT–PCR reaction program included a 95°C denaturation step for 2 minutes followed by 45 cycles of 95°C denaturation for 15 seconds, 62°C annealing for 30 seconds, and 72°C extension for 30 seconds. Detection of fluorescent product was carried out at the end of the 72°C extension period. Melting curve and agarose gel electrophoresis were used to confirm PCR products. Data were analyzed and quantified using Cepheid SmartCycler software.

The reference gene used for normalization was ß-2-microglobulin (B2m). The validity of this gene as a reference was checked by comparing its absolute expression in samples from different groups, provided that the same amount of tissue and then messenger RNA (mRNA) was used for cDNA synthesis. Relative mRNA expression was calculated using the threshold cycle numbers (CT), that is, 2–{Delta}{Delta}CT and was expressed as relative expression to that in normal-AL mice.

Protein Extraction and Immunoblotting
Approximately 100 mg of powdered muscle samples were homogenized in 500 µL of ice-cold homogenizing buffer (20 mM Tris, pH 7.5, 150 mM NaCl, 1% Triton-100), with protease inhibitors and phosphatase inhibitors cocktails (Sigma-Aldrich, St. Louis, MO) and were spun at 20,000 g for 45 minutes. The supernatant was removed and stored at –80°C. Protein concentrations were determined using the BCA assay (Pierce, Rockford, IL) according to the manufacturer's instructions.

Proteins were separated and blotted as previously described (11). Separated proteins were electroblotted onto nitrocellulose and blocked for 1 hour at room temperature with Tris-buffered saline containing 3% nonfat dry milk or 1% bovine serum albumin. The membranes were then incubated with antiserum against Akt2, adenosine monophosphate–activated protein kinase (AMPK)-{alpha}, phospho-AMPK-{alpha} Thr172, p-PKC{lambda}/{zeta}, or Foxo1 (Cell Signaling Technology, Beverly, MA); PKC{zeta} (Santa Cruz Biotechnology, Santa Cruz, CA); Foxo3 (Upstate Biotechnology, Lake Placid, NY); or peroxisome proliferator-activated receptor-{gamma} coactivator-1{alpha} (PGC-1{alpha}; Chemicon, Temecula, CA) overnight. Antigen–antibody complexes were identified using horseradish peroxidase-tagged goat antirabbit and goat antimouse antibodies (Sigma-Aldrich) and were exposed to the enhanced chemiluminescence detection system (Amersham Biosciences, U.K.) for 1 minute. Photos of blots were taken with a CCD camera (Hitachi Genetic Systems, Alameda, CA) and quantified for statistical analysis using GeneTools software (SynGene, Cambridge, U. K.). A minimum of 6 animals per group was analyzed, and Western blots were replicated at least twice.

Enzyme-Linked Immunosorbent Assay
Phosphorylated Akt was analyzed using an enzyme-linked immunosorbent assay (ELISA) kit from BioSource International (Camarillo, CA) according to the manufacturer's protocol. One unit of standard is defined as the amount of p-Akt (S473) derived from 100 pg of Akt, which was phosphorylated by mitogen-activated protein kinase activated protein (MAPKAP2) and phosphoinositide-dependent kinase (PDK)-1.

Statistical Analysis
Data are expressed as means ± standard error. The statistical evaluation was performed using two-factor analysis of variance (ANOVA; phenotype and diet) followed by Fisher's protected least significant differences test as a post hoc test. Student's t test was also used to evaluate the effect of diet within phenotypes and phenotype within diet. A value of p <.05 was considered significant. All statistical analyses were performed using StatView 5.0 software (SAS, Cary, NC).


   RESULTS
Top
 Abstract
 Materials and Methods
 Results
Discussion
 References
 
CR But Not GHRKO Increased AMPK Phosphorylation
CR resulted in increased AMPK phosphorylation (p-AMPK) and, hence, activation (p <.01). Normal-CR animals exhibited increased p-AMPK (p <.01) as compared to normal-AL animals. GHR knockout (KO-CR) animals also exhibited increased p-AMPK levels as compared to GHR knockout ad libitum (KO-AL) (p <.04) (Figure 1). P-AMPK levels were not altered by disruption of the GHR gene.


Figure 01
View larger version (24K):
[in this window]
[in a new window]

  		Figure 1. The level of adenosine monophosphate–activated protein kinase (AMPK) activation in normal and growth hormone receptor-deficient (GHRKO) animals subjected to calorie restriction (CR). In this and the subsequent figures, statistical analysis was done using Student's t test to compare each two groups; groups that do not share a superscript are considered significantly different; p <.05 was considered significant. Values are mean ± standard error. A representative blot is shown. N-AL = Normal ad libitum; N-CR = normal calorie restricted; KO-AL = GHR knockout ad libitum; KO-CR = GHR knockout calorie restricted

 
Active Akt Is Reduced Only in KO-CR Mice
Given the importance of the Akt2 (PKBß) isoform of Akt in the metabolic effects of insulin, we analyzed its mRNA and corresponding protein levels as well as total Akt phosphorylation. Akt2 mRNA expression was reduced by CR only in KO animals (p <.001 KO-CR vs any other group) (Figure 2A). In contrast, total Akt2 protein levels were significantly elevated in normal-CR mice and in KO animals regardless of the diet (p ≤.04, normal-AL vs any other group) (Figure 2B). Analysis of total Akt phosphorylation (Ser473) (p-Akt) using ELISA revealed that CR reduced p-Akt only in KO mice p <.05,) whereas levels of pAkt in KO-AL mice did not differ from those measured in normal-AL mice (Figure 2C).


Figure 02
View larger version (13K):
[in this window]
[in a new window]

  		Figure 2. Relative Akt2 messenger RNA (mRNA) expression as measured by real-time reverse transcription–polymerase chain reaction (A). Akt2 total protein as measured by Western blot (B). See details in Materials and Methods and in
Figure 1. Phosphorylated Akt (Ser473) as measured by enzyme-linked immunosorbent assay (C). Values are mean ± standard error. p <.05. N-AL = Normal ad libitum; N-CR = normal calorie restricted; KO-AL = GHR knockout ad libitum; KO-CR = GHR knockout calorie restricted

 
PKC{lambda}/{zeta} Activation Is Reduced in GHRKO Mice
We also analyzed the message and protein expression of PKC{zeta} and the phosphorylation of PKC{lambda}/{zeta} (p-PKC{lambda}/{zeta}). RT–PCR analysis of PKC{zeta} expression revealed that KO-CR animals had lower mRNA levels as compared to any other group (p ≤.01) (Figure 3A). Total PKC{zeta} protein levels did not differ between groups (representative blots in Figure 3B). The level of p-PKC{lambda}/{zeta} was significantly reduced in GHRKO versus normal mice (p <.01) with no diet effects (Figure 3B).


Figure 03
View larger version (20K):
[in this window]
[in a new window]

  		Figure 3. Gene expression of protein kinase C (PKC){zeta} (A) and phosphorylated (p-) PKC{lambda}/{zeta} (B) in normal and growth hormone receptor-deficient (GHRKO) mice subjected to calorie restriction (CR). N-AL = normal ad libitum; N-CR = normal calorie restricted; KO-AL = GHR knockout ad libitum; KO-CR = GHR knockout calorie restricted

 
Differential Modulation of c-Jun N-Terminal Kinase
Analysis of the active form of c-Jun N-terminal kinase (JNK) MAPK (p-JNK) revealed that JNK1 and JNK2 are regulated differently. JNK1 activation was reduced in KO-AL mice as compared to normal-AL mice and was reduced by CR only in normal animals (p <.003) (Figure 4A). In contrast, p-JNK2 was not altered by phenotype, but was reduced by CR in both normal and KO mice (p <.01, normal-AL vs normal-CR; p <.04, KO-AL vs KO-CR) (Figure 4B).


Figure 04
View larger version (21K):
[in this window]
[in a new window]

  		Figure 4. Active c-Jun N-terminal kinase (JNK)1 (A) and JNK2 (B) in the skeletal muscle of normal and growth hormone receptor-deficient (GHRKO) mice subjected to calorie restriction (CR). N-AL = normal ad libitum; N-CR = normal calorie restricted; KO-AL = GHR knockout ad libitum; KO-CR = GHR knockout calorie restricted; O.D. = optical density

 
Increased PGC-1{alpha} by CR
The gene expression of PGC-1{alpha} was reduced in KO-CR mice only when compared to KO-AL animals (p <.02), with no differences between other groups (Figure 5A). However, the protein level of PGC-1{alpha} was elevated in normal-CR (p <.004) mice as compared to normal-AL mice. A similar trend in KO animals was not statistically significant (p =.1) (Figure 5B).


Figure 05
View larger version (16K):
[in this window]
[in a new window]

  		Figure 5. Gene (A) and protein (B) expressions of peroxisome proliferator-activated receptor-{gamma} coactivator 1{alpha} (PGC-1{alpha}) in normal and growth hormone receptor-deficient (GHRKO) mice subjected to calorie restriction (CR). N-AL = Normal ad libitum; N-CR = normal calorie restricted; KO-AL = GHR knockout ad libitum; KO-CR = GHR knockout calorie restricted; O.D. = optical density

 
Forkhead Transcription Factors Are Reduced in GHRKO Mice
Foxo1 mRNA expression was not altered in KO-AL mice in comparison to normal-AL mice, but was reduced by CR in both phenotypes (p ≤.005). Levels of Foxo1 mRNA measured in KO-CR mice were significantly lower than those in the remaining groups (p ≤.01) (Figure 6A). Two-way ANOVA of Foxo1 protein level revealed that both diet (p <.05) and GHRKO (p <.003) were effective in reducing Foxo1 protein (Figure 6B). Analysis by t test showed that the effect of CR within phenotypes was not statistically significant, whereas KO animals, regardless of diet, exhibited significantly lower Foxo1 protein levels than those in measured in normal-AL mice (p <.05) (Figure 6B).


Figure 06
View larger version (17K):
[in this window]
[in a new window]

  		Figure 6. Foxo transcription factors expression in normal and growth hormone receptor-deficient (GHRKO) mice subjected to calorie restriction (CR): Foxo1 (A) and Foxo3 (B) gene expression as measured by real-time reverse transcription–polymerase chain reaction. Protein levels of Foxo1 (C) and Foxo3 (D) as measured by Western blot. N-AL = Normal ad libitum; N-CR = normal calorie restricted; KO-AL = GHR knockout ad libitum; KO-CR = GHR knockout calorie restricted; O.D. = optical density; mRNA = messenger RNA

 
Similar to that of Foxo1, Foxo3 gene expression was not altered in KO-AL as compared to normal-AL mice but was reduced by CR in both phenotypes. CR resulted in a 44% reduction in Foxo3 mRNA expression in normal mice (p <.002) and a 90% reduction in GHRKO (p <.0002) mice (Figure 6C). At the protein level, two-way ANOVA showed effects of both diet (p <.05) and phenotype (p <.0001) in reducing Foxo3 protein level (Figure 6D). However, CR did not significantly affect Foxo3 protein levels in either phenotype. Regardless of the diet, GHRKO mice had lower Foxo3 protein expression than did normal animals (p ≤.005) (Figure 6D).


   DISCUSSION
Top
 Abstract
 Materials and Methods
 Results
 Discussion
References
 
We previously reported that, in comparison to normal mice fed AL, both CR and GHRKO animals show signs of increased hepatic gluconeogenesis and lipid oxidation. These signs were manifested by increased levels of proteins that promote these processes (including Foxo1, PGC-1{alpha}, p38, and CREB) and by decreased Akt activation in the liver associated with reduced circulating insulin and IGF-1 levels (11). In the present study, we used skeletal muscle tissue from the same animals to further dissect the overlapping as well as distinct mechanisms of the action of CR and reduced IGF-1/insulin signaling in long-lived rodents.

AMPK is known to play a major role in energy regulation. It is activated during cellular stresses when the AMP/adenosine triphosphate (ATP) ratio increases to favor catabolic pathways that generate ATP and inhibit anabolic pathways that consume ATP (13). AMPK was reported to increase glucose uptake and fatty acid oxidation in muscle while repressing fatty acid and protein synthesis (13). We recently reported that hepatic AMPK phosphorylation was increased in GHRKO animals with no effects of CR (11). However, in the skeletal muscle examined in the present study, both normal and GHRKO mice showed increased AMPK activation by CR. This finding is in agreement with the reduction in glucose level by CR in these animals, but was not expected from measurement of plasma adiponectin levels, which were elevated only in GHRKO mice (11) (Table 1). This result suggests differential activation of this protein in liver and skeletal muscle. Adiponectin was previously shown to activate AMPK in liver and muscle and to induce fatty acid oxidation, glucose uptake, and lactate production in myocytes (14). However, while both globular and full-length adiponectin were able to activate AMPK in muscle, only full-length adiponectin activated AMPK in liver (14). Our results differ from those in a recent report by Gonzalez and colleagues (15) in which CR did not affect AMPK activity in the skeletal muscle of 5-month-old mice. This discrepancy could be explained by differences in the genetic background and/or the age of the mice (21 vs 5 months), although the same research group also reported no effects of aging on AMPK activation (16). However, CR could be more effective in activating AMPK at an older age.


View this table:
[in this window]
[in a new window]

  		Table 1. Body Weight and Various Plasma Parameters from Normal and GHRKO Mice Subjected to Caloric Restriction.

 
Akt/PKB, a serine/threonine kinase, is a critical intermediate in phosphoinositide 3-kinase's (PI3K) metabolic and antiapoptotic effects (17). Studies on the nematode Caenorhabditis elegans have revealed that reduction-of-function mutations in Akt1 and Akt2 extend the longevity of the nematode in a Daf-16 (a homolog of the mammalian Foxo transcription factors)–dependent manner (18). Moreover, Akt was recently reported to negatively regulate the life span of primary cultured human endothelial cells (19). Despite reduced insulin and IGF-1 in normal-CR and KO-AL animals (11), active Akt in the muscle was not significantly altered, indicating a possible mechanism of compensation for this reduction and hence increased insulin sensitivity. KO-CR mice had very low glucose levels (11) and exhibited reduced Akt activation, which would presumably conserve glucose for other organs. The present results also differed from our previous finding in livers of the same animals [active Akt was lower in GHRKO than in normal mice and was reduced by CR in normal but not in GHRKO mice (11)]; those findings implied tissue specific activity of this kinase and differential modulation by CR and GHRKO in liver and muscle. McCurdy and colleagues (20) reported that insulin-stimulated Akt2 but not Akt1 phosphorylation was increased after brief CR, and was accompanied by a reduction in total Akt1 protein expression with no effect on total Akt2. In the present study, total Akt2 protein was increased by CR in normal mice and in GHRKO as compared to normal-AL animals with no changes in Akt1 protein abundance. These findings imply specific importance of Akt2 in mediating insulin action in skeletal muscle and are consistent with results of studies on Akt isoforms KO mice. Whereas Akt1-null mice have normal glucose metabolism but are growth retarded (21), Akt2 knockout mice have impaired glucose tolerance and are insulin resistant (22). CR and GH resistance in GHRKO animals appears to exert qualitatively similar effects on Akt2 expression. It is of particular interest that, in the present study, CR significantly increased Akt2 protein levels in normal animals in which life span was extended but not in GHRKO animals in which longevity was not altered by this intervention.

Like Akt, atypical PKC isoforms {lambda} and {zeta} are downstream of PI3K and are required for maximal insulin-induced glucose transport. Obesity and/or type 2 diabetes mellitus were reported to be associated with reduced insulin-stimulated PKC{lambda}/{zeta} activation in skeletal muscle (23–26). Moreover, thiazolidinediones (TZDs), which are important insulin-sensitizing agents, have been found to improve this defect in atypical PKC activation (reviewed in 27). GHRKO animals have increased insulin sensitivity; however, they manifest glucose intolerance primarily due to decreased glucose-stimulated insulin secretion (3). Although hepatic PKC{lambda}/{zeta} phosphorylation was not affected by CR or in GHRKO mice (Al-Regaiey KA, Masternak MM, Bartke A, unpublished observations, 2004), GHRKO mice exhibited reduced phosphorylated PKC{lambda}/{zeta} in the skeletal muscle which could further contribute to poor glucose disposal in these animals in response to glucose challenge.

JNK is a member of the MAPKs and is activated in response to various stress signals, including cytokines and oxidative stress (28). This kinase was reported to promote insulin resistance through the phosphorylation of insulin receptor substrate (IRS-1) at Ser307, which inhibits coupling of IRS-1 to the insulin receptor (29,30). Further studies revealed that JNK mediates a negative feedback pathway for insulin action (31). Moreover, it was shown that JNK is abnormally activated in obesity and that obesity and insulin resistance are decreased in mice homozygous for a targeted mutation in the Jnk1 but not Jnk2 gene (32). In the present study, active JNK1 was significantly reduced in normal-CR, GHRKO-AL, and GHRKO-CR mice, suggesting a possible involvement in the enhancement of insulin sensitivity by the absence of GH signaling in GHRKO mice and by the action of CR in normal animals. The suggested involvement of reduced JNK1 activation in mediating the effects of CR is strongly supported by our recent observations that CR improved insulin sensitivity and increased longevity in normal mice in which p-JNK1 levels were suppressed but not in GHRKO mice in which they were not affected (7). JNK2 activation, however, was only reduced by CR with no genotype effect. JNK was reported to be activated by high glucose (33,34). Reduced JNK2 in CR animals could be associated with reduced glucose and could provide additional advantage for these animals in terms of insulin sensitivity.

PGC-1{alpha} is a transcription coactivator that is involved in multiple biological responses related to energy homeostasis, thermal regulation and mitochondrial biogenesis, glucose metabolism, and muscle fiber type differentiation (35,36). CR resulted in increased PGC-1{alpha} protein level in the skeletal muscle of normal mice, whereas a trend for a similar increase in GHRKO mice was not significant. This result differs from PGC-1{alpha} expression in the livers of the animals in which additive effects of CR and GHRKO were observed (11). It was recently reported that cold-induced PGC-1{alpha} activation increases insulin-stimulated glucose uptake, glucose transporter 4 (GLUT4) expression, and membrane localization in an AMPK-dependent manner (37). Increased PGC-1{alpha} protein level and AMPK activation by CR is a likely mechanism to increase insulin sensitivity and reduce insulin demand. The importance of skeletal muscle PGC-1{alpha} levels in the control of insulin sensitivity is consistent with the observation that, in the present study, PGC-1{alpha} protein was significantly increased only in normal animals. Normal, but not GHRKO mice respond to CR by increased ability of injected insulin to suppress circulating glucose levels (7).

Foxo1 and Foxo3 proteins were reduced in GHRKO animals. This finding differs from our findings in the liver of the same animals in which Foxo1 protein was elevated (11). The function of Foxo proteins in skeletal muscle is not well defined. Mice that overexpress Foxo1 in skeletal muscle have reduced muscle mass and type 1 fibers and exhibit impaired glycemic control, implying negative impact of Foxo1 on muscle mass and glucose metabolism (38). Moreover, IGF-1, through the PI3K/Akt pathway, inhibits muscle atrophy by suppressing Foxo transcription factors, which leads to the suppression of muscle ubiquitin ligases MAFbx and MuRF1 (39,40). Therefore, decreased Foxo proteins in the skeletal muscle of GHRKO mice may represent a protective mechanism against muscle atrophy and wasting in the setting of low insulin and IGF-1 levels in these animals. Higher levels of Foxo proteins in normal-AL as compared to GHRKO animals could be related to the age-related decline in their body weight and could possibly mediate sarcopenia. Moreover, greater abundance of Foxo proteins in normal animals could be attributed to differences in the rate of biological aging between normal and GHRKO mice. Pyruvate dehydrogenase kinase PDK-4 phosphorylates and deactivates pyruvate dehydrogenase, which results in inhibition of glucose oxidation and insulin resistance (41). Foxo transcription factors were found to stimulate PDK-4 gene expression (42) and insulin inhibits PDK-4 by inhibiting Foxo proteins (43). Therefore, reduced Foxo proteins in the muscle of GHRKO mice might be another compensatory mechanism to increase glucose uptake and increase insulin sensitivity.

Summary
We have examined the activity of multiple molecules involved in glucose homeostasis in the skeletal muscle of normal and GH-resistant long-lived GHRKO mice with and without CR. The activity of these molecules is differentially regulated in liver and skeletal muscle due possibly to their different functions in different tissues. In the skeletal muscle, PKC{lambda}/{zeta} and JNK1 activation were reduced in GHRKO as compared to normal mice. CR was effective in increasing AMPK activation and reducing JNK2 activation as well as Foxo1 and Foxo3 mRNA levels in both normal and GHRKO mice. Suppression of Akt2, PKC {lambda}/{zeta}, and PGC-1{alpha} messages and of pAkt protein in response to CR were detected only in GHRKO animals, and thus are apparently not involved in the regulation of whole-animal insulin sensitivity or longevity or, less likely, interfere with the beneficial effects of CR. Increases in the Akt2 and PGC-1{alpha} proteins and a reduction in pJNK1 protein in response to CR occurred only in normal animals; this finding could be related to the mechanisms of enhanced insulin sensitivity and extension of longevity. Further studies are needed to test this suggestion. Collectively, the present results support the conclusion from previous studies (4,11) that CR and reduced activity of the somatotropic axis extend longevity by overlapping but distinct mechanisms.


   Acknowledgments
Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
This work was supported by grants from the National Institute on Aging (AG 19899 and U19 AG023122) and The Ellison Medical Foundation. John J. Kopchick was supported, in part, by the State of Ohio's Eminent Scholar Program that includes a grant from Milton and Lawrence Goll and by DiAthengen, LLC.

We thank the members of Bartke's laboratory for laboratory assistance and thoughtful discussions.


   Footnotes
Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Decision Editor: Huber R. Warner, PhD

Received March 10, 2006

Accepted June 29, 2006


   References
Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

  1. Zhou Y, Xu BC, Maheshwari HG, et al. A mammalian model for Laron syndrome produced by targeted disruption of the mouse growth hormone receptor/binding protein gene (the Laron mouse). Proc Natl Acad Sci U S A. 1997;94:13215-13220.[Abstract/Free Full Text]
  2. Coschigano KT, Clemmons D, Bellush LL, Kopchick JJ. Assessment of growth parameters and lifespan of GHR/BP gene disrupted mice. Endocrinology. 2000;141:2608-2613.[Abstract/Free Full Text]
  3. Liu JL, Coschigano KT, Robertson K, et al. Disruption of growth hormone receptor gene causes diminished pancreatic islet size and increased insulin sensitivity in mice. Am J Physiol Endocrinol Metab. 2004;287:E405-E413.[Abstract/Free Full Text]
  4. Miller RA, Chang Y, Galecki AT, Al-Regaiey K, Kopchick JJ, Bartke A. Gene expression patterns in calorically restricted mice: partial overlap with long-lived mutant mice. Mol Endocrinol. 2002;16:2657-2666.[Abstract/Free Full Text]
  5. Masternak MM, Al-Regaiey KA, Del Rosario Lim MM, et al. Effects of caloric restriction on insulin pathway gene expression in the skeletal muscle and liver of normal and long-lived GHR-KO mice. Exp Gerontol. 2005;40:679-684.[Medline]
  6. Masternak MM, Al-Regaiey KA, Del Rosario Lim MM, et al. Effects of caloric restriction and GH resistance on the expression level of peroxisome proliferator-activated receptors (PPARs) superfamily in the liver of normal and long-lived GHR-KO mice. J Gerontol A Biol Sci Med Sci. 2005;60A:1394-1398.[Abstract/Free Full Text]
  7. Bonkowski MS, Rocha JS, Masternak MM, Al Regaiey KA, Bartke A. Targeted disruption of growth hormone receptor interferes with the beneficial actions of calorie restriction. Proc Natl Acad Sci U S A. 2006;103:7901-7905 Epub 2006 May 8.[Abstract/Free Full Text]
  8. Dominici FP, Hauck S, Argentino DP, Bartke A, Turyn D. Increased insulin sensitivity and upregulation of insulin receptor, insulin receptor substrate (IRS)-1 and IRS-2 in liver of Ames dwarf mice. J Endocrinol. 2002;173:81-94.[Abstract]
  9. Dominici FP, Argentino DP, Bartke A, Turyn D. The dwarf mutation decreases high dose insulin responses in skeletal muscle, the opposite of effects in liver. Mech Ageing Dev. 2003;124:819-827.[Medline]
  10. Dominici FP, Arostegui Diaz G, Bartke A, Kopchick JJ, Turyn D. Compensatory alterations of insulin signal transduction in liver of growth hormone receptor knockout mice. J Endocrinol. 2000;166:579-590.[Abstract]
  11. Al-Regaiey KA, Masternak MM, Bonkowski M, Sun L, Bartke A. Long-lived growth hormone receptor knockout mice: interaction of reduced IGF-1/insulin signaling and caloric restriction. Endocrinology. 2005;146:851-860.[Abstract/Free Full Text]
  12. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987;162:156-159.[Medline]
  13. Hardie DG. Minireview: the AMP-activated protein kinase cascade: the key sensor of cellular energy status. Endocrinology. 2003;144:5179-5183.[Abstract/Free Full Text]
  14. Yamauchi T, Kamon J, Minokoshi Y, et al. Adiponectin stimulates glucose utilization and fatty-acid oxidation by activating AMP-activated protein kinase. Nat Med. 2002;8:1288-1295.[Medline]
  15. Gonzalez AA, Kumar R, Mulligan JD, Davis AJ, Weindruch R, Saupe KW. Metabolic adaptations to fasting and chronic caloric restriction in heart, muscle, and liver do not include changes in AMPK activity. Am J Physiol Endocrinol Metab. 2004;287:E1032-E1037.[Abstract/Free Full Text]
  16. Gonzalez AA, Kumar R, Mulligan JD, Davis AJ, Saupe KW. Effects of aging on cardiac and skeletal muscle AMPK activity: basal activity, allosteric activation, and response to in vivo hypoxemia in mice. Am J Physiol Regul Integr Comp Physiol. 2004;287:R1270-R1275.[Abstract/Free Full Text]
  17. Lawlor MA, Alessi DR. PKB/Akt: a key mediator of cell proliferation, survival and insulin responses? J Cell Sci. 2001;114:2903-2910.[Medline]
  18. Paradis S, Ruvkun G. Caenorhabditis elegans Akt/PKB transduces insulin receptor-like signals from AGE-1 PI3 kinase to the DAF-16 transcription factor. Genes Dev. 1998;12:2488-2498.[Abstract/Free Full Text]
  19. Miyauchi H, Minamino T, Tateno K, Kunieda T, Toko H, Komuro I. Akt negatively regulates the in vitro lifespan of human endothelial cells via a p53/p21-dependent pathway. EMBO J. 2004;23:212-220.[Medline]
  20. McCurdy CE, Davidson RT, Cartee GD. Brief calorie restriction increases Akt2 phosphorylation in insulin-stimulated rat skeletal muscle. Am J Physiol Endocrinol Metab. 2003;285:E693-E700.[Abstract/Free Full Text]
  21. Cho H, Thorvaldsen JL, Chu Q, Feng F, Birnbaum MJ. Akt1/PKB{alpha} is required for normal growth but dispensable for maintenance of glucose homeostasis in mice. J Biol Chem. 2001;276:38349-38352.[Abstract/Free Full Text]
  22. Cho H, Mu J, Kim JK, et al. Insulin resistance and a diabetes mellitus-like syndrome in mice lacking the protein kinase Akt2 (PKBß). Science. 2001;292:1728-1731.[Abstract/Free Full Text]
  23. Beeson M, Sajan MP, Dizon M, et al. Activation of protein kinase C-{zeta} by insulin and phosphatidylinositol-3,4,5-(PO4)3 is defective in muscle in type 2 diabetes and impaired glucose tolerance: amelioration by rosiglitazone and exercise. Diabetes. 2003;52:1926-1934.[Abstract/Free Full Text]
  24. Kim YB, Kotani K, Ciaraldi TP, Henry RR, Kahn BB. Insulin-stimulated protein kinase C {lambda}/{zeta} activity is reduced in skeletal muscle of humans with obesity and type 2 diabetes. Reversal with weight reduction. Diabetes. 2003;52:1935-1942.[Abstract/Free Full Text]
  25. Sajan MP, Standaert ML, Miura A, et al. Impaired activation of protein kinase C-{zeta} by insulin and phosphatidylinositol-3,4,5-(PO4)3 in cultured preadipocyte-derived adipocytes and myotubes of obese subjects. J Clin Endocrinol Metab. 2004;89:3994-3998.[Abstract/Free Full Text]
  26. Standaert ML, Ortmeyer HK, Hansen BC, et al. Skeletal muscle insulin resistance in obesity-associated type 2 diabetes mellitus in monkeys is linked to a defect in insulin activation of protein kinase C-{lambda}/{zeta}/{iota}. Diabetes. 2002;51:2936-2943.[Abstract/Free Full Text]
  27. Farese RV. Function and dysfunction of a PKC isoform for glucose transport in insulin-sensitive and insulin-resistant states. Am J Physiol Endocrinol Metab. 2002;283:E1-E11.[Abstract/Free Full Text]
  28. Nishina H, Wada T, Katada T. Physiological roles of SAPK/JNK signaling pathway. J Biochem (Tokyo). 2004;136:123-126.[Abstract/Free Full Text]
  29. Aguirre V, Uchiuda T, Yenush L, Davis R, White MF. The c-Jun NH2-terminal kinase promotes insulin resistance during association with insulin receptor substrate-1 and phosphorylation of Ser307. J Biol Chem. 2000;275:9047-9054.[Abstract/Free Full Text]
  30. Aguirre V, Werner ED, Giraud J, Lee YH, Shoelson SE, White MF. Phosphorylation of ser307 in insulin receptor substrate-1 blocks interactions with the insulin receptor and inhibits insulin action. J Biol Chem. 2002;277:1531-1537.[Abstract/Free Full Text]
  31. Lee YH, Giraud J, Davis RJ, White MF. cJUN N-terminal kinase (JNK) mediates feedback inhibition of the insulin signaling cascade. J Biol Chem. 2003;278:2896-2902.[Abstract/Free Full Text]
  32. Hirosumi J, Tuncman G, Chang L, et al. A central role for JNK in obesity and insulin resistance. Nature. 2002;420:333-336.[Medline]
  33. Cheng HL, Feldman EL. Bidirectional regulation of p38 kinase and c-Jun N-terminal protein kinase by insulin-like growth factor-I. J Biol Chem. 1998;273:14560-14565.[Abstract/Free Full Text]
  34. Purves T, Middlemas A, Agthong S, et al. A role for mitogen-activated protein kinases in the etiology of diabetic neuropathy. FASEB J. 2001;15:2508-2514.[Abstract/Free Full Text]
  35. Lin J, Wu H, Tarr PT, et al. Transcriptional co-activator PGC-1{alpha} drives the formation of slow-twitch muscle fibres. Nature. 2002;418:797-801.[Medline]
  36. Puigserver P, Spiegelman BM. Peroxisome proliferator-activated receptor-{gamma} coactivator 1{alpha} (PGC-1{alpha}): transcriptional coactivator and metabolic regulator. Endocr Rev. 2003;24:78-90.[Abstract/Free Full Text]
  37. Oliveira RL, Ueno M, de Souza CT, et al. Cold-induced PGC-1alpha expression modulates muscle glucose uptake through an insulin receptor/Akt-independent, AMPK-dependent pathway. Am J Physiol Endocrinol Metab. 2004;287:E686-E695.[Abstract/Free Full Text]
  38. Kamei Y, Miura S, Suzuki M, et al. Skeletal muscle FOXO1 (FKHR) transgenic mice have less skeletal muscle mass, down-regulated Type I (slow twitch/red muscle) fiber genes, and impaired glycemic control. J Biol Chem. 2004;279:41114-41123.[Abstract/Free Full Text]
  39. Sandri M, Sandri C, Gilbert A, et al. Foxo transcription factors induce the atrophy-related ubiquitin ligase atrogin-1 and cause skeletal muscle atrophy. Cell. 2004;117:399-412.[Medline]
  40. Stitt T, Drujan D, Clarke B, et al. The IGF-1/PI3K/Akt pathway prevents expression of muscle atrophy-induced ubiquitin ligases by inhibiting FOXO transcription factors. Mol Cell. 2004;14:395-403.[Medline]
  41. Harris RA, Huang B, Wu P. Control of pyruvate dehydrogenase kinase gene expression. Adv Enzyme Regul. 2001;41:269-288.[Medline]
  42. Furuyama T, Kitayama K, Yamashita H, Mori N. Forkhead transcription factor FOXO1 (FKHR)-dependent induction of PDK4 gene expression in skeletal muscle during energy deprivation. Biochem J. 2003;375:365-371.[Medline]
  43. Kwon HS, Haung B, Unterman TG, Harris R. Protein kinase B-{alpha} inhibits human pyruvate dehydrogenase kinase-4 gene induction by dexamethasone through inactivation of FOXO transcription factors. Diabetes. 2004;53:899-910.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Journals of Gerontology Series A: Biological Sciences and Medical SciencesHome page
J. F. Giani, M. S. Bonkowski, M. C. Munoz, M. M. Masternak, D. Turyn, A. Bartke, and F. P. Dominici
Insulin Signaling Cascade in the Hearts of Long-Lived Growth Hormone Receptor Knockout Mice: Effects of Calorie Restriction
J. Gerontol. A Biol. Sci. Med. Sci., August 1, 2008; 63(8): 788 - 797.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
N. L. Brooks, C. M. Trent, C. F. Raetzsch, K. Flurkey, G. Boysen, M. T. Perfetti, Y.-C. Jeong, S. Klebanov, K. B. Patel, V. R. Khodush, et al.
Low Utilization of Circulating Glucose after Food Withdrawal in Snell Dwarf Mice
J. Biol. Chem., November 30, 2007; 282(48): 35069 - 35077.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Services
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
PubMed
Right arrow PubMed Citation

HOME ARCHIVE SEARCH TABLE OF CONTENTS