HomeLarge Type Edition
HOME ARCHIVE SEARCH TABLE OF CONTENTS
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Services
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
PubMed
Right arrow PubMed Citation
The Journals of Gerontology Series A: Biological Sciences and Medical Sciences 61:444-460 (2006)
© 2006 The Gerontological Society of America

daf-16 Protects the Nematode Caenorhabditis elegans During Food Deprivation

Samuel T. Henderson, Massimiliano Bonafè and Thomas E. Johnson

1 Institute for Behavioral Genetics, University of Colorado, Boulder.
2 Department of Experimental Pathology, and Center for Applied Biomedical Research, University of Bologna, Italy.

Address correspondence to Thomas E. Johnson, PhD, Institute for Behavioral Genetics, Box 447, University of Colorado, Boulder, CO 80309. E-mail: johnsont{at}colorado.edu


   Abstract
Top
 Abstract
Methods
 Results
 Discussion
 References
 
Inhibition of either the insulin-like or target of rapamycin (TOR) pathways in the nematode Caenorhabditis elegans extends life span. Here, we demonstrate that starvation and inhibition of the C. elegans insulin receptor homolog (daf-2) elicits a daf-16-dependent up-regulation of a mitochondrial superoxide dismutase (sod-3). We also find that although heat and oxidative stress result in nuclear localization of the DAF-16 protein, these stressors do not activate a SOD-3 reporter, suggesting that nuclear localization alone may not be sufficient for transcriptional activation of DAF-16. We show that inhibition of either TOR activity or key components of the cognate translational machinery (eIF-4G and EIF-2B homologs) increases life span by both daf-16-dependent and -independent mechanisms. Finally, we demonstrate that at least one nematode hexokinase is localized to the mitochondria. We propose that the increased life spans conferred by alterations in both the TOR and insulin-like pathways function by inappropriately activating food-deprivation pathways.

MODIFYING any one of several nutrient-sensing molecular mechanisms, either by RNA interference (RNAi) or by mutation, can increase the life span of the nematode Caenorhabditis elegans. Two prominent examples of such pathways are the insulin/insulin-like growth factor (IGF)-1 signaling cassette and the target of rapamycin (TOR) protein [for overview, see (1,2)].

The best studied of these mechanisms is the insulin/IGF-like signaling (IIS) pathway. Many components of this signaling cassette were identified initially as mutations in the dauer-formation pathway of C. elegans. Dauers are a long-lived dispersal stage that forms when conditions are unfavorable for reproductive development [for overview, see (3)]. Genetic screens have identified many mutations that either cause the animals to form dauers constitutively, called Daf-c, or not at all, called Daf-d (dauer defective). Subsequent studies revealed that some Daf-c mutations also confer long life. For example, the first long-lived mutant identified, age-1 (4–6), was found to be allelic with the Daf-c gene, daf-23, and encodes a putative phosphatidylinositol-3-kinase (7). A large number of studies have examined this pathway, and have confirmed the observation that reducing IIS by mutation or RNAi increases both mean and maximum life span [for review, see (1)]. Components of the IIS pathway are present throughout life and, similar to mammalian IIS, may function to transmit information on nutrient availability to individual cells, allowing for adaptation to a changing environment (8,9). In particular, IIS is most active when food is abundant, and functions to promote reproductive development. IIS is reduced under conditions of low food and leads to dauer formation. Therefore, mutations in the IIS pathway result in the inappropriate signal of adverse conditions, in particular low food, under conditions of abundance.

One of the major functions of IIS in C. elegans is to regulate the activity of the forkhead transcription factor DAF-16. daf-16 is required for both dauer formation and the increased life span of many long-lived strains of nematodes (10,11). DAF-16 plays a key role in modulating C. elegans life span, such that loss of daf-16 shortens life span, whereas simply increasing the dosage of daf-16 increases life span (9,12). Active IIS negatively regulates DAF-16 by sequestering the protein to the cytoplasm, thereby preventing activation of target genes, whereas inhibition of IIS causes nuclear localization of DAF-16 and possible activation of target genes (9,12,13). This method of regulation acts as a rapid means to adjust transcriptional profiles in response to a changing environment. A variety of methods have revealed potential targets of DAF-16, which include several antioxidant genes such as sod-3 (mitochondrial Mn superoxide dismutase; 14–17) and ctl-1 (a cytoplasmic catalase; 15). In addition to genetic alterations in IIS, several environmental factors, such as increased temperature, oxidative stress, and starvation, cause DAF-16 to enter the nucleus, suggesting that DAF-16 may play a more general role in adaptation to adverse conditions (9).

A second pathway for increasing life span in C. elegans is the TOR protein (2). TOR proteins are an evolutionarily conserved family of proteins that function as a nutrient-sensing mechanism and regulate protein synthesis and degradation in response to changing amino acid levels. Low amino acid levels inhibit TOR function resulting in inhibition of protein synthesis and increased protein degradation. Abundant amino acids activate TOR and lead to increased protein synthesis and decreased degradation [for review, see (18)]. Inhibition of the C. elegans homolog of TOR, let-363, results in a phenotype similar to starved animals (19) and modest increases in life span (2). Similar to IIS inhibition, genetic inhibition of TOR transmits the signal that resources are scarce when they are not.

The increased life span by inappropriate signals of adversity has been proposed in various models of aging and especially in the context of the "disposable soma" theory of aging as put forth by Kirkwood and coauthors (20–22). The disposable soma theory proposes that organisms distribute limited resources across the general categories of reproduction and somatic maintenance. When nutrients are abundant, selection would favor species that devote resources toward reproduction. Yet, when resources are scarce, somatic maintenance may be favored, as the organism "hunkers down" until conditions improve. Hence, when presented with a changing environment, a balance must be struck between allocating resources toward reproduction versus somatic maintenance [for recent review, see (23)].

The allocation of resources may be influenced by perceived nutrient availability. For example, if nutrient-sensing pathways are disrupted by mutation, they may send the signal that nutrients are scarce, causing a reallocation of resources toward cellular repair. One outward sign of such a reallocation may be increased resistance to external stressors [for overview, see (24)]. In particular, increased resistance to reactive oxygen species (ROS) may be critical for increased life span. Oxidative stress has been proposed as a major factor in many pathological conditions as well as in the aging process itself (25,26).

Here we show that, in addition to its role in dauer formation, DAF-16 functions to protect animals from oxidative damage during periods without food. Depriving C. elegans of food for several days rendered animals more sensitive to oxidative stress, yet increased their resistance to heat. We also show that after 4 days without food animals lacking a functional daf-16 gene had greatly elevated carbonyl content. We used a sod-3::GFP reporter construct as a reporter of DAF-16 transcriptional activity, and demonstrate that sod-3 is induced primarily by DAF-16 in response to food availability. Furthermore, we find that at least one nematode hexokinase is localized to mitochondria, and we suggest that starvation may induce oxidative stress in nematodes the same way as in mammals. We also show that whereas inhibition of TOR activity increases life span in a daf-16-independent manner, inhibition of key components of the translational machinery can increase life span in a daf-16-dependent manner. Finally, we propose that the increases in life span conferred by alterations in both the TOR and IIS pathways function by inappropriately signaling that conditions are adverse when they are not and that daf-16 plays a key role in this response.


   METHODS
Top
 Abstract
 Methods
Results
 Discussion
 References
 
Strains and Culture Conditions
Strains were maintained on nematode growth media (NGM) plates spread with Escherichia coli strain OP50 using standard procedures (27) unless stated otherwise. Strains used were: N2 (CGCb); DA465: eat-2(ad465)II; GR1307: daf-16(mgDf50)I; TJ356: N2; zIs356 [pGP30 (daf-16::GFP)] (9); TJ1052: age-1(hx546)II; TJ1060: spe-9(hc88)I; fer-15(b26)II; TJ1062: spe-9(hc88)I; fer-15(b26) age-1(hx542)II; TJ1081: daf-16(m26)I; fer-15(b26)II (28); CL2166: N2; dvIs19 [pAF15 (gst-4::GFP-NLS)] (29).

Starvation.-- Gravid adults of temperature-sensitive sterile strains, such as TJ1060, were grown at 16°C to ensure fertility on 2% peptone plates spread with E. coli strain RW2. Mixed populations were washed off the plate and treated with hypochlorite and NaOH to isolate eggs. Eggs were placed at 25°C on 2% peptone plates spread with RW2 and grown for 4 days to become sterile adults. RW2 grows to a thick bacterial lawn and was used instead of OP50 to grow large numbers of animals and prevent the animals from encountering low food conditions prior to the experimental food deprivation. When the animals reached 4 days of age, the population was split and animals were place in either (1x S Basal) with 1 x 109 E. coli/mL or 1x S Basal without E. coli. Media was changed every 3 days.

Life span and stress tests.-- Life spans of fed and starved populations were followed as previously described, and survival curves were compared with the log rank test (30). Stress tests were performed by exposing both the starved and fed populations to the indicated stress, and then scoring a sample of the population at a given time point for the number of live and dead animals. For juglone, 2 mM juglone was dissolved in 100% EtOH and diluted to 300 µm in 1x S Basal for testing. Hydrogen peroxide was used at 50 mM. Due to the large variability in oxidative stress tests, replicate experiments were not compared to each other. Only within-replicate comparisons were analyzed. Survival proportions between fed and starved strains were compared with the Fisher Exact test. Statistical analysis was performed with the Statistica software package (Statsoft Inc., Tulsa, OK) and graphed with SigmaPlot (SPSS Inc., Chicago, IL).

Plasmids
Cloning of DNA fragments was done following standard procedures (31). DNA for polymerase chain reaction (PCR) was isolated from N2 (CGCb) (32).

sod-3::GFP.-- Primers sod3u1 CCFormulaCGCAGAAAAAAGTCGTTGCAA and sod3d1 TAFormulaATTGTCGAGCATTGCAAATCT were used to amplify a 2.3-kb fragment from N2 genomic DNA, digested with SalI/XmaI, and cloned into pPD95.81 (provided by Dr. Andrew Fire, Stanford University) to create the sod-3::GFP expression vector. N2 animals were given injections of 20 µg/mL sod-3::GFP plasmid and 100 µg/mL pRF4 to establish transgenic lines N2; zEx373 (TJ373) and N2; zEx374 (TJ374). Extrachromosomal array zEx373 was crossed into GR1307 and daf-16(mgDf50) homozygotes segregated to yield TJ378: daf-16(mgDf50)I; zEx373.

H25P06.1::GFP.-- Primers h25u1 CGFormulaTTGCAAATCAAAATCGTGGA and h25d1 CCGGFormulaTCAATCGATTCTTCATTCAGTTTCGA were used to amplify a 720-bp fragment containing the first two exons of H25P06.1 and the putative promoter region from N2 genomic DNA. The PCR fragment was cloned into pSTblue using a Perfectly Blunt PCR cloning kit (Novagen Inc., Madison, WI). A PstI/BamHI fragment was then cloned out of this construct and into pPD95.81 to yield the H25P06.1::GFP translational fusion. H25P06.1::GFP at 20 µg/mL and pRF4 at 100 µg/mL were co-injected into N2 to derive N2; zExH25P06.1::GFP strains, TJ376 and TJ377.

RNAi
To inhibit specific gene function, we used a standard RNAi protocol and used empty vector RNAi as a control (listed as control(RNAi)) (33). For M110.4 and K04G2.1, RNAi feeding bacteria were obtained from the whole genome RNAi library (34). For let-363, primers tor1 CATTCAAAAATCGAGCGTGA and tor2 TTGGAACCCAACCAATCAAT (identical to primer pair sjj_B0261.2, www.wormbase.org) were used to amplify a 1-kb fragment from N2 genomic DNA, blunted with Perfectly Blunt reagent (Novagen, Inc.) and cloned into EcoRV digested, phosphatased pPD129.36 (provided by A. Fire). daf-16 and daf-2 RNAi constructs were as previously described (9).

Microscopy
Animals were soaked in 1X S Basal containing 10 mM tetramethylrosamine (TMR) (Molecular Probes, Inc., Eugene, OR) for 1 hour, then washed briefly in fresh 1x S Basal. Green fluorescent protein (GFP) and TMR staining were visualized with a Zeiss (Thornwood, NY) Axiovert microscope, using a digital camera and SlideBook software (Intelligent Imaging Innovations Inc., Denver, CO).

Western Blots
N2; Exsod-3::GFP transgenics were grown on either empty vector RNAi (control(RNAi)) or daf-2(RNAi) as previously described (34). Ten adult rollers were picked off each RNAi plate and boiled in 5 µl of lysis buffer (50 mM Tris [pH 6.8], 2% sodium dodecyl sulfate [SDS], 50 mM dithiothreitol [DTT]) at 95°C for 10 minutes to dissolve the carcasses. Western blot procedure was done following standard methods (31), using anti-GFP antibody (Sigma Inc., St. Louis, MO). Signal was detected using enhanced chemiluminescence (Amersham Biosciences Inc., Piscataway, NJ) on BioMax film (Kodak, Inc., Rochester, NY).

Carbonyl Determination
Worm extract and blotting.-- Animals were resuspended in 1x lysis buffer (50 mM Tris [pH 6.8], 2% SDS, 50 mM DTT) and heated to 95°C for 10 minutes to dissolve the carcasses. Carbonyls were detected in worm extract using an Oxyblot Protein Oxidation Detection Kit (Chemicon International, Inc., Temecula, CA) in a dot blot procedure following manufacturer's directions. Briefly, 5 µl of protein sample was denatured in 6% SDS, derivatized with 2,4-dinitrophenylhydrazine, neutralized, then blotted to nitrocellulose membrane using a suction apparatus (Bio-Rad, Inc., Hercules, CA). Blots were then blocked with Blotto (5% dried milk) for 1 hour, followed by incubation with primary antibody (rabbit anti-dinitrophenyl [DNP]) for 1 hour at room temperature, washed three times in 1x Tris-buffered saline, incubated 1 hour with secondary antibody (goat anti-rabbit horseradish peroxidase conjugate); the blot was then finally washed three times in 1x Tris-buffered saline. The blot was developed with an enhanced chemiluminescence kit (Amersham, Inc.) onto BioMax film (Kodak, Inc.) and analyzed with ImageJ software (NIH, Bethesda, MD). Carbonyl content is based on pixel counts per microgram of protein in the sample.

Protein determination.-- We found that DTT and SDS used in the preparation of our worm extract interfered with the bicinchoninic acid (BCA) protein assay. To remove these compounds, we dialyzed worm extract in small volumes using Slide-A-Lyser Mini dialysis units (Pierce, Inc., Rockford, IL) against two changes of 1 liter of phosphate-buffered saline at 4°C. Following dialysis, protein content was determined using the BCA method following manufacturer's directions (BCA Protein Assay Kit; Pierce Inc.).


   RESULTS
Top
 Abstract
 Methods
 Results
Discussion
 References
 
Starvation and daf-2 Inactivation Induce sod-3 Expression in a daf-16-Dependent Manner
We have previously shown that heat shock, exposure to juglone (a superoxide generator), or starvation results in rapid nuclear localization of a DAF-16::GFP fusion protein (9). Yet, nuclear localization may not necessarily lead to transcription and translation of target genes. To visualize DAF-16 output, we constructed a SOD-3::GFP translational fusion that fuses GFP to the C-terminus of the complete SOD-3 protein, and uses the endogenous sod-3 promoter (Figure 1A). sod-3 is one of two mitochondrial superoxide dismutases in C. elegans and is a known target of DAF-16 (14,35).


Figure 01
View larger version (22K):
[in this window]
[in a new window]
  		Figure 1. Expression of sod-3::GFP. All animals shown are adult TJ373 (Exsod-3::GFP transgenics). A, Construction of sod-3::GFP fusion gene. Plasmid contains 2 kb of sequence upstream of sod-3, the entire predicted sod-3 coding region, and the coding region for green fluorescent protein fused in-frame to the C-terminus of the predicted SOD-3 protein. B, Adult pharynx showing GFP fluorescence. Arrows indicate prominent GFP areas. C, Adult pharynx stained with mitochondrial dye, tetramethylrosamine (TMR). Arrows indicate prominent TMR staining. D, Merge of GFP and TMR images, showing partial colocalization of TMR and GFP in several areas. E, 100x GFP image of untreated animals. Anterior is left. Note pharyngeal fluorescence and weak posterior gut expression. F, 100x GFP image of an animal transferred to 37°C for 30 minutes and allowed to recover for 4 hours. SOD-3::GFP is not increased under these conditions. G, 100x GFP image of an animal treated for 18 hours in 100% oxygen at 40 psi. Note weak gut GFP signal. H, 100x image of an animal exposed to daf-2 RNA interference (RNAi). Note strong expression in many cell types. Inset: Western blot using antibodies to GFP. Left lane, animals grown on empty vector RNAi (con); right lane, daf-2 RNAi. Each lane contains extract of 10 transgenic animals

 
In wild-type animals, the SOD-3::GFP protein is expressed constitutively and weakly in pharyngeal and intestinal cells (Figure 1B and E). In the pharynx, SOD-3::GFP appears in some instances to colocalize with the mitochondrial dye TMR (Figure 1C and D). However, much of the SOD-3::GFP appears not to overlap with the TMR dye; this is especially evident when sod-3 expression is induced (see below and Supplemental Figure 1). Therefore, we cannot rule out the possibility that the presence of the GFP interferes with the targeting of the protein. We tested if the constitutive expression was dependent on daf-16 using RNAi and by crossing the array into a daf-16-null-allele background (daf-16(mgDf50)) and found that the pharyngeal pattern was independent of daf-16 (see Figure 2F). Identical daf-16 RNAi treatments result in silencing of the transgene, suppression of dauer formation, and shortening of life span (9). To see if our construct was responsive to inhibition of IIS, we inhibited daf-2 by RNAi and noted strong induction of SOD-3::GFP in many tissue types, in particular hypodermis, intestine, and somatic gonad (Figure 1H and inset). The induction of sod-3::GFP by daf-2(RNAi) did not occur in a daf-16(lf) background, indicating that DAF-16 plays a significant role in activating sod-3 in the absence of IIS (Figure 2A and B). We examined the localization of the induced SOD-3::GFP protein and found that, in some cell types (such as the somatic gonad) SOD-3::GFP colocalized with TMR (Supplemental Figure 1A–D), yet in others it was frequently found to be outside of the mitochondria; for example, it appeared to be associated with aggregates in the intestine (Supplemental Figure 1B and D) and dense bodies in muscle cells (Supplemental Figure 1E–H). The aggregates and accumulation at dense bodies may be an artifact of highly expressed transgenes.


Figure 01
View larger version (104K):
[in this window]
[in a new window]
  		Supplemental Figure 1. sod-3::GFP strongly expressed after insulin/IGF-like signaling (IIS) inhibition. All animals shown are TJ373 (Exsod-3::GFP) raised on daf-2 RNA interference (RNAi). A, Differential interference contrast (DIC) image of adult animal, showing intestinal cells, germline, and somatic gonad. B, Green fluorescence protein (GFP) image of same animal shown in A. Arrow indicates GFP fluorescence in somatic gonad. Also note GFP aggregates in intestinal cells. C, Tetramethylrosamine (TMR) image of animal shown in A. Arrow indicates TMR staining in somatic gonad. Note absence of TMR aggregates in intestine. D, Merge of GFP and TMR images. Arrow indicates colocalization of GFP and TMR staining in somatic gonad. Note lack of colocalization in intestine. E, DIC image of adult animal, showing hypodermal cells and muscle cells. F, GFP image of same animal shown in E. Arrow indicates GFP fluorescence near dense bodies. G, TMR image of animal shown in E. Note stringy mitochondrial staining. H, Merge of GFP and TMR images. Note lack of colocalization of GFP and TMR staining in hypodermis, possibly due to high levels of expression

 

Figure 02
View larger version (92K):
[in this window]
[in a new window]
  		Figure 2. Starvation and inhibition of daf-2 activates sod-3::GFP. All animals shown are Exsod-3::GFP transgenics. Note, the transgene is an extrachromosomal array and not all animals carry the marker. A, Differential interference contrast (DIC) image of a daf-16(lf) (top) and daf-16(+) (bottom) animal grown on daf-2(RNAi). B, Green fluorescence protein (GFP) image of animals shown in A. Note stronger GFP signal in daf-16(+) animal. We conclude that daf-16 is required for full sod-3 induction by DAF-2. C, DIC image of a field of larval animals grown on empty vector RNA interference (RNAi) (control(RNAi)) then starved for 2 days in liquid medium (see Methods). D, GFP image of animals shown in C. Note strong GFP signal in subset of animals. E, DIC image of a field of larvae grown on daf-16 RNAi, then starved for 2 days in liquid medium. F, GFP image of animals shown in E. Note lack of GFP induction in these animals. G, GFP image of an adult animal grown on empty vector RNAi and then starved for 2 days in liquid medium; note increase in GFP fluorescence; anterior is left. H, GFP image of an adult animal grown on daf-16 RNAi then starved for 2 days in liquid medium; note lack of GFP induction. Anterior is left

 
Because heat, ROS, and starvation all result in nuclear localization of DAF-16::GFP (9), we asked if such treatments activated our sod-3::GFP reporter. We tested exposure to 35°C for 2 hours, 37°C for 30 minutes, hyperbaric oxygen, or 24 hours of food deprivation. Despite nuclear localization by heat and oxidative stress (9), we did not detect significant increases in SOD-3::GFP fluorescence by these treatments (Figure 1F and G). Of these treatments, only starvation strongly induced the transgene (Figure 2D and G). We next tested the dependence of this induction on DAF-16 and found that the starvation-induced expression of the sod-3::GFP transgene could be completely suppressed by pre-exposing the worms to daf-16 RNAi (Figure 2E–H).

SOD-3::GFP Did Not Increase Life Span
In some cases, nematodes carrying transgenes have extended longevity [examples include: daf-16 (9,13), old-1 (36–38), hsf-1 (39), and hsp-16.1 (40)]. Earlier work had provided evidence that overexpression of SOD (41) or SOD and catalase (42) could extend the life span of Drosophila. However, this extension may only apply to short-lived strains of flies (43). Given the role of SOD in combating oxidative stress and that our construct contained a full-length SOD-3 protein, we examined the life span of two independent sod-3::GFP transgenic lines (in three replicate experiments) compared to a line carrying the roller marker alone and found no difference in mean life span (ExpRF4:17.3 ± 2.0 days, Exsod-3::GFP line #1: 17.2 ± 1.7 days, p =.44, Exsod-3::GFP line #2:17.2 ± 2.2 days, p =.99). However, given the poor mitochondrial localization of our construct, we cannot exclude the possibility that the SOD-3::GFP protein may be nonfunctional.

DAF-16 Does Not Regulate All Oxidative Stress-Induced Genes
Because activation of DAF-16 increases expression of sod-3, we determined if DAF-16 could regulate other known antioxidant genes. Previous work had identified a gst-4::GFP fusion construct as a robust reporter of oxidative stress (29). In well-fed, wild-type animals, gst-4::GFP is expressed weakly in hypodermal cells (Figure 3A, C, and E) and can be induced in other cell types (notably intestinal cells) by exposure to oxygen (Figure 3B). In our tests, gst-4::GFP did not behave like sod-3::GFP. For example, sod-3::GFP could be induced by starvation whereas gst-4::GFP could not; also gst-4::GFP could be induced by hyperbaric oxygen exposure, whereas sod-3::GFP could not (Figure 1G). We further examined the responsiveness of gst-4::GFP to changes in IIS in adult animals. Because inhibition of daf-2 led to strong induction of sod-3::GFP, we next tested if daf-2(RNAi) would activate gst-4::GFP. We found no strong activation, although inhibition of daf-2 may cause weak expression in anterior intestinal cells (Figure 3C). Also, inhibition of daf-2 did not influence the induction of gst-4::GFP by oxygen (Figure 3D). We next tested the daf-16 dependence of gst-4::GFP expression by exposing the animals to daf-16(RNAi), and found that DAF-16 was not required for either constitutive expression (Figure 3E) or oxygen-induced expression (Figure 3F). Similar to daf-2(RNAi), we noted slight activation of gst-4::GFP on daf-16(RNAi) which may be in response to elevated ROS in daf-16(lf) animals. daf-16 mutants are known to be sensitive to oxidative stress (see below) and rapidly accumulate hallmarks of oxidative damage, such as protein carbonyls (44). Therefore, the increased oxidative stress induced by suppression of daf-16 may activate the gst-4 reporter, yet DAF-16 itself may not turn on a broad range of antioxidant genes.


Figure 03
View larger version (86K):
[in this window]
[in a new window]
  		Figure 3. gst-4::GFP. Green fluorescence protein (GFP) images of adult CL2166 (Isgst-4::GFP) transgenic animals shown at 400x. Construct contains a nuclear localization signal and induction is most notable by increased fluorescence in intestinal nuclei. A, Image of an untreated animal raised on empty vector RNA interference (RNAi). Note expression in hypodermal cells. B, Image of an animal treated for 18 hours in 100% oxygen at 40 psi; note prominent GFP fluorescence in intestinal nuclei (arrows). C, Image of an animal exposed to daf-2 RNAi; note weak induction in anterior intestinal cells (arrow). D, Image of an animal exposed to daf-2 RNAi and treated for 18 hours in 100% oxygen at 40 psi; note strong intestinal induction. E, GFP image of an animal exposed to daf-16 RNAi; note weak induction in anterior intestinal cells (arrow). F, GFP image of an animal fed on daf-16 RNAi and treated for 18 hour in 100% oxygen at 40 psi; note strong induction in intestinal cells

 
DAF-16 Protects Starved Animals From Oxidative Stress
The daf-16-dependent induction of sod-3 implies that starved or IIS-inhibited animals are experiencing or anticipating oxidative stress, notably superoxide generation by the mitochondria. We tested sensitivity to exogenous oxidative stress (as a surrogate indicator of oxidative stress) in starved versus fed animals. To prevent internal hatching during starvation we used the sterile strains [TJ1060, daf-16(+) and TJ1081, daf-16(m26)], which have defects in sperm function, yet the germ lines remain intact and the animals continue to produce oocytes and have normal life spans (28). We examined resistance to ROS of animals starved for 48 hours (a time point at which sod-3::GFP is activated in animals starved on solid media). We first tested resistance to juglone, a superoxide generator, and found that starved TJ1060 animals are more sensitive to juglone than are fed animals (Figure 4A), suggesting that the starved animals may be experiencing endogenous oxidative stress that is not completely countered by protective measures. We next examined a daf-16 mutant [TJ1081, daf-16(m26)] and, as expected, fed daf-16(lf) animals were more sensitive to juglone treatment then were fed daf-16(+) animals, consistent with the well-characterized stress sensitivity of daf-16 mutants (45). Importantly, we found that starved daf-16(lf) animals were markedly sensitive to juglone (see Figure 4A), indicating that daf-16(lf) animals may lack the ability to activate antioxidant defenses in response to starvation, and are rendered extremely sensitive to superoxide.


Figure 04
View larger version (22K):
[in this window]
[in a new window]
  		Figure 4. Starved vs fed animals. A–C and E, Solid lines and filled symbols represent fed animals; dashed lines and open symbols represent starved animals. Circles indicate strains that are daf-16(+); triangles indicate daf-16(m26) strains. A–C and E show one representative experiment of three replicates. A, Juglone. Loss of daf-16 renders animals sensitive to 300 µM juglone, a superoxide generator. Starvation greatly increases sensitivity. Survival proportions between fed and starved strains were compared at different time points with the Fisher Exact test. daf-16(+) fed vs daf-16(+) starved p value <.001. daf-16(m26) fed vs daf-16(m26) starved p value <.001. B, Hydrogen peroxide. Starved animals are more sensitive to 50 mM hydrogen peroxide than are fed animals. Survival proportions between fed and starved strains were compared with the Fisher Exact test. daf-16(+) fed vs daf-16(+) starved p =.0123. daf-16(m26) fed vs daf-16(m26) starved p =.0165. C, Life span. Starvation shortens life span of both daf-16(+) and daf-16(m26) strains of adult Caenorhabditis elegans. Comparison of life spans done by log rank test. Result of log rank test for experiment shown: daf-16(+) fed (24.1 ± 0.8) vs daf-16(+) starved (20.6 ± 0.8), p =.0024; daf-16(m26) fed (18.6 ± 0.6) vs daf-16(m26) starved (16.4 ± 0.4) p =.0008. D, Carbonyls. Filled columns indicate fed animals, open columns indicate animals starved for 4 days. Starvation increases carbonyl content per microgram of protein in daf-16(m26) animals. Values of p represent comparison of means. daf-16(+) fed (33.6 ± 10.3) vs daf-16(+) starved (42.2 ± 3.2) p = 0.507, daf-16(+) fed (33.6 ± 10.3) vs daf-16(m26) fed (91.1 ± 1.7) p =.0312, daf-16(+) fed (33.6 ± 10.3) vs daf-16(m26) starved (152.5 ± 7.5) p =.0112. E, Heat. Starvation increases thermotolerance of both daf-16(+) and daf-16(lf) strains of adult C. elegans. One representative experiment is shown. Survival proportions between fed and starved strains were compared with the Fisher Exact test. daf-16(+) fed vs daf-16(+) starved p <.001. daf-16(m26) fed vs daf-16(m26) starved p <.001

 
Inhibition of any one of several mitochondrial genes has been demonstrated to increase the life span of C. elegans (46,47), and these long-lived animals show differential sensitivity to two oxidative stressors: paraquat and hydrogen peroxide. Generally, inhibiting mitochondria decreased resistance to paraquat, yet increased resistance to hydrogen peroxide (47). Paraquat acts in a similar manner to juglone, using NADPH to generate superoxide (48). Therefore, we asked if starved animals exhibited this pattern of sensitivity, perhaps due to decreased mitochondrial output during food deprivation. However, unlike mitochondrial mutants, starved daf-16(+) and daf-16(lf) animals were more sensitive to both juglone and hydrogen peroxide, with starved daf-16(lf) animals showing the greatest sensitivity to both juglone and hydrogen peroxide (Figure 4A and B).

Because starvation appeared to induce oxidative stress, we next tested the effect starvation had on life span. We grew animals on E. coli until they were adults (4 days) and then switched the population to liquid media (1x S Basal) half with 1 x 109 E. coli/mL and half without food (see Methods section). Under these conditions, starvation shortened life span of both daf-16(+) and daf-16(lf) animals (Figure 4C). This phenotype could be reversed by even relatively small amounts of food. For example, feeding animals on a dietary restriction regimen (approximately 1 x 107 E. coli/mL) increased the life span of both daf-16(+) and daf-16(lf) strains (Table 1).


View this table:
[in this window]
[in a new window]
  		Table 1. Life Spans.

 
The sensitivity to both juglone and hydrogen peroxide is an indirect measure of oxidative stress. We next determined levels of carbonyls in fed versus starved animals after 4 days of food deprivation. daf-16(+) animals did not accumulate increased carbonyls during this period of starvation. Yet, the absence of daf-16 greatly increased carbonyls per microgram of protein during the period of starvation (Figure 4D), suggesting that one function of DAF-16 is to protect animals from oxidative stress during periods without food.

Because starvation shortened life span and made the animals more sensitive to exogenously applied oxidative stressors, it was possible that starvation simply made the animals less healthy in general. Therefore, we tested the thermotolerance of starved versus fed animals. Interestingly, we found that starved animals were much more thermotolerant than were fed animals and that this increased thermotolerance was daf-16 independent. Both starved daf-16(+) and and daf-16(lf) animals were markedly more thermotolerant than were fed animals of the same genotype (Figure 4E).

C. elegans Hexokinase H25P06.1 Is Localized to the Mitochondria
In mammals, growth factor withdrawal and glucose deprivation trigger nuclear localization of the DAF-16 homolog, FoxO3a, and increases SOD2 expression (the mammalian ortholog of sod-3). The activation of SOD2 has been proposed as protection against low hexokinase activity at the voltage-dependent anion channel (VDAC; 49). In mammals, type I hexokinase is targeted to the mitochondria by a hydrophobic sequence located at the amino terminus of the protein (MIAAQLLAYY) (50). C. elegans contains three putative hexokinase genes H25P06.1, Y77E11A.1, and F14B4.2. We aligned these sequences and examined them for the presence of hydrophobic N-terminal sequences (see Figure 5A inset). H25P06.1 contained 50% hydrophobic sequences at the N-terminal (MLGIIELGIQ), whereas F14B4.2 contained 40% (MSSIVCHPIL) and Y77E11A.1 only 30% (MKVLPPEVEE). Therefore, the H25P06.1 protein was the best candidate for mitochondrial targeting.


Figure 05
View larger version (50K):
[in this window]
[in a new window]
  		Figure 5. Hexokinase. A, H25P06.1::GFP fusion construct. The first two exons containing putative mitochondrial targeting sequence of H25P06.1 were fused in-frame with green fluorescence protein (GFP). Inset: alignment of the first 10 amino acids of rat hexokinase and three predicted Caenorhabditis elegans hexokinase proteins: H25P06.1, F14B4.2, and Y77E11A.1. Hydrophobic amino acids shown in red. B, Differential interference contrast (DIC) image of a fourth-stage-larval animal. C, GFP image of animal shown in A; note stringy pattern of GFP. D, Tetramethylrosamine (TMR) image of animal shown in A. Note stringy pattern of mitochondria in hypodermal cells. E, Merge of GFP and TMR images. Note colocalization of H25P06.1::GFP fusion protein and mitochondrial dye in hypodermal cells

 
To determine if nematode hexokinase proteins may be localized to the mitochondria, we constructed a fusion between the first two exons of H25P06.1 (containing putative VDAC targeting sequence) and GFP. Expression was driven by 2 kb of genomic sequence upstream of the H25P06.1 coding region (Figure 5A). We found that this construct exhibits broad expression, with notable expression in pharynx, neurons, and muscle cells. The fusion also exhibits clear mitochondrial localization as revealed by TMR co-staining (Figure 5, B–E). This preliminary result suggests that, like mammals, but unlike yeast, C. elegans may use intramitochondrial adenosine triphosphate (ATP) to phosphorylate glucose. We were unable to obtain expression of either F14B4.2 or Y77E11A.1 GFP fusion constructs.

Inhibition of C. elegans TOR Homolog (let-363) and Translational Regulatory Genes Increases Life Span
Low levels of amino acids, such as those experienced during starvation, inhibit the activity of the evolutionarily conserved TOR protein, resulting in inhibition of transcription and translation, thereby slowing growth in response to low nutrient levels [for review, see (51)]. We asked if inhibition of the C. elegans homolog of TOR, let-363, by RNAi resulted in phenotypes similar to those seen in starved animals and if these phenotypes were dependent on daf-16. let-363 RNAi resulted in larval lethality, as previously described; arrested animals and escapers were small and thin and possessed numerous refractile granules (19). Because let-363(RNAi) resulted in larval arrest, we were unable to examine life span in these animals. To decrease the inhibition of let-363, we lowered the concentration of isopropyl-beta-D-thiogalactopyranoside (IPTG) in the media to 1 nM as described (33) and observed lessening of the phenotype. These animals were small and pale, yet grew to adults that were long-lived similar to those in previous reports (2). The life-span extension was found to be independent of daf-16 (Table 1).

Given the role of TOR in nutrient sensing, we next tested the effect of inhibiting let-363 in an eat-2(lf) background. Eat mutants are a class of mutants that are defective in feeding, frequently through disruption of pharynx structure or function. eat-2 encodes a beta subunit of the nicotinic acetylcholine receptor superfamily which controls rates of pharyngeal pumping. eat-2(lf) mutants pump slower, and are pale and long lived, hence they are considered a genetic model of dietary restriction (52). Dietary restriction may increase life span by reducing nutrient intake and work via TOR signaling. We found that inhibition of let-363 led to an average increase in life span of {approx}18% in an eat-2(ad465) background compared to {approx}8% in a wild-type background, suggesting that inhibition of let-363 works synergistically with eat-2 mutants (see Table 1).

One of the major effects of inhibiting TOR is blocking protein translation. Decreased expression of either the homolog to eukaryotic translation initiation factor 4 gamma, eIF-4G (M110.4), or eukaryotic translation initiation factor 2 beta, eIF-2ß (K04G2.1), gives a phenotype similar to inhibiting let-363 (19). We asked if inhibition of either of these genes would result in life-span extension using two different RNAi treatments. In the first treatment, parents were placed on RNAi feeding plates as L3s and were allowed to lay eggs; then the life span of the F1 generation was followed. In the second experiment, young adults were placed on the feeding plates, and their life spans were followed. We noted increased life span using both regimens (Figure 6). Animals exposed to RNAi to each of the translational regulatory genes for their entire lives were small and pale, as previously described (19), yet did not undergo developmental arrest as did let-363-inhibited animals. In contrast, animals exposed to translational RNAi as adults appeared phenotypically normal yet exhibited extended longevity.


Figure 06
View larger version (18K):
[in this window]
[in a new window]
  		Figure 6. Translation. Inhibition of translation extends life span. Solid lines represent animals raised on control RNA interference (RNAi), and dashed lines represent animals raised on RNAi vector to inhibit either M110.4 (left) or K04G2.1 (right). Values of p represent comparison by log rank test for experiment shown. Strains were either daf-16(+) or daf-16(m26) and raised at 25.5°C. A–D, Effect of inhibition of translation throughout development. Mean life spans for each strain: TJ1060 (daf-16(+)): control(RNAi) 14.2 ± 0.4, M110.4(RNAi) 18.6 ± 0.3, K04G2.1(RNAi) 16.1 ± 0.4; TJ1081 (daf-16(m26)): control(RNAi) 14.8 ± 0.3, M110.4(RNAi) 16.5 ± 0.3, K04G2.1(RNAi) 16.1 ± 0.4. E–H, Effect of inhibition of translation in adult animals. Mean life spans TJ1060(daf-16(+)): control(RNAi) 12.6 ± 0.6, M110.4(RNAi) 18.3 ± 0.8, K04G2.1(RNAi) 14.6 ± 0.5; TJ1081 (daf-16(m26)): control(RNAi) 11.3 ± 0.2, M110.4(RNAi) 11.9 ± 0.3, K04G2.1(RNAi) 12.2 ± 0.3

 
We next tested the dependence of the increased life span on daf-16 by exposing daf-16(lf) mutants to RNAi to M110.4 and K04G2.1. Similar to let-363 inhibition, the life span increases were found to be largely independent of daf-16 when translation was inhibited throughout development (Figure 6C and D). However, when translation was inhibited as adults, longevity increases were found to be daf-16 dependent (Figure 6G and H), suggesting that inhibition of translation has differential effects on life span depending on when it occurs. We next tested the ability of inhibiting translational machinery to activate our sod-3::GFP reporter. Consistent with a daf-16-dependent extension of life span, we found that inhibiting translation as adults increased levels of the SOD-3::GFP protein (Figure 7), implicating a role for IIS in this means of life-span extension.


Figure 07
View larger version (33K):
[in this window]
[in a new window]
  		Figure 7. Inhibition of translation activates sod-3::GFP. All animals shown are TJ373 (Exsod-3::GFP). A, Green fluorescence protein (GFP) image of animal raised on control RNA interference (RNAi). B, GFP image of adult animal raised on M110.4 RNAi. Note presence of SOD-3::GFP in intestinal cells. C, GFP image of adult animal raised on K04G2.1 RNAi. SOD-3::GFP present in intestinal cells

 

   DISCUSSION
Top
 Abstract
 Methods
 Results
 Discussion
References
 
A common stress encountered by most animals is lack of available food. Accordingly, nutrient-sensing pathways have evolved to adjust behavior and cellular processes to changing dietary resources. Recent evidence has demonstrated that disruption of two such pathways increases life span in C. elegans, as well as other animals. For example, inhibition of TOR increases life span of nematodes (2) and fruit flies (53). Similarly, inhibition of IIS increases life span in nematodes (5,54), fruit flies (55), mice (56), and perhaps even in humans (57).

Why would inhibition of a nutrient-sensing pathway increase life span? One shared feature of both the TOR and IIS pathways is that active signaling is required to signal favorable conditions, whereas the default setting (absence of signal) signals adverse conditions. Therefore, disruption of these pathways results in a signal that resources are scarce. For example, mutations in IIS in nematodes results in dauer formation even in the presence of abundant food. In C. elegans, the active signal is thought to originate from sensory neurons in the head through direct chemosensory input of food signals from the environment. Hence, ablating the sensory neurons or disrupting their formation acts like inhibition of IIS and results in dauer formation or a daf-16-dependent extension of life span (58). In the case of nematode TOR signaling, inhibition of TOR results in a phenocopy of starvation by inhibiting translation and increasing protein degradation (19). TOR signaling differs somewhat from signaling via IIS in that TOR directly tracks intracellular amino acid levels, whereas IIS monitors food availability in the environment. Yet, despite these differences, the general mechanism that leads to increased life span when these pathways are inhibited may be a shift in life strategy toward maintenance and repair and away from reproduction (59–61).

Although signals of deprivation may increase life span, the precise mechanism remains unclear. Here we have shown that one normal function of DAF-16 is to protect C. elegans from oxidative stress during periods of low food availability. Depriving animals of food for 2–4 days led to increased sensitivity to exogenous oxidative stress. Loss of DAF-16 function led to increased carbonyl accumulation and increased sensitivity to exogenous stress, especially during starvation. Interestingly, we were unable to detect large increases in gst-4::GFP in response to IIS inhibition. Also, genome-wide expression studies of Age mutants have generally failed to show broad increases in antioxidant gene expression, other than for sod-3 (15,16), nor were these genes induced during the aging processes (62). One explanation for this finding is our observation that DAF-16 normally activates genes in response to scarce nutrient levels. If food levels are low, glucose levels are also likely to be low and there may be decreased production of reducing equivalents such as NADPH. In mammals, NAPDH is generated by glucose flowing through the pentose pathway and is used for both reductive synthesis and recycling of glutathione and thioredoxin [for overview, see (26)]. Therefore, under conditions of low glucose, there may be decreased levels of reducing equivalents and lowered ability to recycle glutathione. Hence, under these conditions, activation of glutathione enzymes may not be useful. Instead, measures to directly combat oxidants, such as superoxide dismutase and catalase, may be favored.

Previous studies have shown that a variety of stressors such as heat, oxidative stress, and starvation resulted in nuclear localization of DAF-16 (9). In the present study, we found that, despite DAF-16 nuclear localization under these conditions, all such treatments did not lead to activation of our sod-3::GFP reporter construct, suggesting that nuclear localization alone may not be sufficient to activate DAF-16 target genes. Other factors are known to influence the ability of DAF-16 and FoxO proteins to activate transcription, including: DNA binding, association with cofactors, and the phosphorylation and/or acetylation state [for review, see (63)]. Stressors that disturb the nuclear/cytoplasmic transport system may also disturb the activation state of DAF-16. For example, heat may disrupt the association of DAF-16 with 14-3-3 proteins allowing translocation to the nucleus, but may also disrupt the association with transcriptional co-activators such as CBP-1 (64). Also, because we tested only a single reporter gene, it is possible that different stressors induce a different set of DAF-16 targets. For example, in mammals, the acetylation state of FoxO may influence the balance between pro-apototic and cell cycle arrest genes (65). Alternatively, the inability of DAF-16 to activate sod-3 in response to heat and oxidative stress may indicate that DAF-16 functions primarily to protect the organism from starvation, whereas other factors (such as HSF-1) protect against heat (39), and (SKN-1) against oxidative stress (66).

The activation of a superoxide dismutase gene by DAF-16 is remarkably similar to the situation in mammalian cells, in which glucose deprivation is known to cause oxidative stress, which is countered by FoxO3a-dependent activation of SOD2 (49). In mammals, one prominent source of oxidative stress during glucose deprivation is low hexokinase activity at the mitochondrial VDAC [aka porin; (67)]. We have shown that at least one C. elegans hexokinase, H25P06.1, may be localized to the mitochondria and that nematodes may also couple glycolysis with mitochondrial function. This finding suggests that a similar pathway may operate in nematodes and that protection from oxidative stress, promoted by low nutrient levels, is a conserved function of FoxO proteins across phyla.

Consistent with previous findings (2), we found that inhibition of the C. elegans TOR homolog, let-363, extended life span in a daf-16-independent manner. We extended these findings by observing that inhibition of translation alone could also increase life span and that in some cases the increased life span was daf-16 dependent. Inhibition of M110.4 or K04G2.1 throughout development resulted in small sterile animals with extended longevity. These increases in life span were independent of daf-16. The phenotypes of these animals were similar to inhibition of mitochondrial genes, which also has been shown to result in small animals with increased life span (46,47). It is possible that inhibition of translation inhibits mitochondrial proliferation during development and that this is the source of increased life span. However, unlike the mitochondrial genes, we found that inhibition of translation as adult animals also increased life span. Furthermore, we found that this increase in life span was dependent on daf-16 and resulted in activation of sod-3::GFP, suggesting that inhibition of translation in adults works through IIS to extend longevity. Because active IIS is required for short life span, inhibition of translation may function to inhibit IIS. One possible mechanism is decreased production of IIS components such as the insulin-like ligand or signaling kinases encoded by daf-2, pdk-1, age-1, or akt-1/2. Translation of growth signals may be sensitive to inhibition, because growth would not be a priority under adverse conditions. Differential translation of genes under stress conditions is well recognized (68).

Summary
We propose that a normal function of DAF-16 in C. elegans is to protect animals from oxidative stress during periods of low food availability. This function may be conserved across phyla from nematodes to mammals. In both cases, hexokinase protein is associated with mitochondria and may link glycolysis with ROS production. Furthermore, in both cases, orthologous proteins, members of the FoxO class of transcription factors, activate mitochondrial superoxide dismutases in response to nutrient deprivation. Consistent with this observation, we found that in the absence of DAF-16 animals are rendered extremely sensitive to ROS during periods of starvation and rapidly accumulate carbonyls. Conversely, inappropriate activation of DAF-16 increases both stress resistance and life span, possibly by activating defense mechanisms when they are not needed. Interestingly, we also found that inhibition of both the C. elegans homolog of TOR, let-363, and components of the translational machinery also extend life span, and in some cases work through DAF-16. The extension of life span conferred by both inhibition of IIS and the TOR pathway is consistent with protective programs acting as the default state and growth-promoting programs requiring constant signaling. This default state would be advantageous in the wild, where it would be beneficial for an animal to rapidly adapt to nutrient deprivation. Activation of these deprivation pathways when they are not needed may be an important means to life extension.


   Acknowledgments
Top
 Abstract
 Methods
 Results
 Discussion
 References
 
This work was supported by grants from the National Institutes of Health (NIH; RO1-AG12423, R01-AG16219, and KO2-AA00195) and by gifts from the Ellison Medical Foundation and the Glenn Foundation for Medical Research. Some nematode strains were provided by the Caenorhabditis Genetics Center, which is funded by the National Center for Research Resources (NCRR) of the NIH.


   Footnotes
Top
 Abstract
 Methods
 Results
 Discussion
 References
 
Decision Editor: James R. Smith, PhD

Received May 13, 2005

Accepted November 8, 2005


   References
Top
 Abstract
 Methods
 Results
 Discussion
 References
 

  1. Guarente L, Kenyon C. Genetic pathways that regulate ageing in model organisms. Nature. 2000;408:255-262.[Medline]
  2. Vellai T, Takacs-Vellai K, Zhang Y, Kovacs AL, Orosz L, Muller F. Genetics: influence of TOR kinase on lifespan in C. elegans. Nature. 2003;426:620.[Medline]
  3. Riddle DL, Albert PS. Genetic and Environmental Regulation of Dauer Larva Development in C. Elegans II. Riddle DL, Blumenthal T, Meyer BJ, Priess JR, eds. Plainview, NY: Cold Spring Harbor Press; 1997:739–768.
  4. Klass MR. A method for the isolation of longevity mutants in the nematode Caenorhabditis elegans and initial results. Mech Ageing Dev. 1983;22:279-286.[Medline]
  5. Friedman DB, Johnson TE. A mutation in the age-1 gene in Caenorhabditis elegans lengthens life and reduces hermaphrodite fertility. Genetics. 1988;118:75-86.[Abstract/Free Full Text]
  6. Johnson TE. Increased life-span of age-1 mutants in Caenorhabditis elegans and lower Gompertz rate of aging. Science. 1990;249:908-912.[Abstract/Free Full Text]
  7. Morris JZ, Tissenbaum HA, Ruvkun G. A phosphatidylinositol-3-OH kinase family member regulating longevity and diapause in Caenorhabditis elegans. Nature. 1996;382:536-539.[Medline]
  8. Kimura KD, Tissenbaum HA, Liu Y, Ruvkun G. daf-2, an insulin receptor-like gene that regulates longevity and diapause in Caenorhabditis elegans. Science. 1997;277:942-946.[Abstract/Free Full Text]
  9. Henderson ST, Johnson TE. daf-16 integrates developmental and environmental inputs to mediate aging in the nematode Caenorhabditis elegans. Curr Biol. 2001;11:1975-1980.[Medline]
  10. Ogg S, Paradis S, Gottlieb S, et al. The Fork head transcription factor DAF-16 transduces insulin-like metabolic and longevity signals in C. elegans. Nature. 1997;389:994-999.[Medline]
  11. Lin K, Dorman JB, Rodan A, Kenyon C. daf-16: an HNF-3/forkhead family member that can function to double the life-span of Caenorhabditis elegans. Science. 1997;278:1319-1322.[Abstract/Free Full Text]
  12. Lin K, Hsin H, Libina N, Kenyon C. Regulation of the Caenorhabditis elegans longevity protein DAF-16 by insulin/IGF-1 and germline signaling. Nat Genet. 2001;28:139-145.[Medline]
  13. Lee RY, Hench J, Ruvkun G. Regulation of C. elegans DAF-16 and its human ortholog FKHRL1 by the daf-2 insulin-like signaling pathway. Curr Biol. 2001;11:1950-1957.[Medline]
  14. Honda Y, Honda S. The daf-2 gene network for longevity regulates oxidative stress resistance and Mn-superoxide dismutase gene expression in Caenorhabditis elegans. FASEB J. 1999;13:1385-1393.[Abstract/Free Full Text]
  15. Murphy CT, McCarroll SA, Bargmann CI, et al. Genes that act downstream of DAF-16 to influence the lifespan of Caenorhabditis elegans. Nature. 2003;424:277-283.[Medline]
  16. McElwee J, Bubb K, Thomas JH. Transcriptional outputs of the Caenorhabditis elegans forkhead protein DAF-16. Aging Cell. 2003;2:111-121.[Medline]
  17. Larsen PL. Direct and indirect transcriptional targets of DAF-16. Sci Aging Knowledge Environ. 2003;2003:PE9.
  18. Hay N, Sonenberg N. Upstream and downstream of mTOR. Genes Dev. 2004;18:1926-1945.[Abstract/Free Full Text]
  19. Long X, Spycher C, Han ZS, Rose AM, Muller F, Avruch J. TOR deficiency in C. elegans causes developmental arrest and intestinal atrophy by inhibition of mRNA translation. Curr Biol. 2002;12:1448-1461.[Medline]
  20. Kirkwood TB. Evolution of ageing. Nature. 1977;270:301-304.[Medline]
  21. Kirkwood TB, Holliday R. The evolution of ageing and longevity. Proc R Soc Lond B Biol Sci. 1979;205:531-546.[Medline]
  22. Kirkwood TB, Rose MR. Evolution of senescence: late survival sacrificed for reproduction. Philos Trans R Soc Lond B Biol Sci. 1991;332:15-24.[Medline]
  23. Kirkwood TB. Understanding the odd science of aging. Cell. 2005;120:437-447.[Medline]
  24. Johnson TE, Cypser J, de Castro E, et al. Gerontogenes mediate health and longevity in nematodes through increasing resistance to environmental toxins and stressors. Exp Gerontol. 2000;35:687-694.[Medline]
  25. Harman D. Aging: a theory based on free radical and radiation chemistry. J. Gerontol. 1956;2:298-300.
  26. Beckman KB, Ames BN. The free radical theory of aging matures. Physiol Rev. 1998;78:547-581.[Abstract/Free Full Text]
  27. Brenner S. The genetics of Caenorhabditis elegans. Genetics. 1974;77:71-94.[Abstract/Free Full Text]
  28. Fabian TJ, Johnson TE. Production of age-synchronous mass cultures of Caenorhabditis elegans. J Gerontol. 1994;49:B145-B156.
  29. Link CD, Johnson CJ. Reporter transgenes for study of oxidant stress in Caenorhabditis elegans. Methods Enzymol. 2002;353:497-505.[Medline]
  30. Johnson TE, Wood WB. Genetic analysis of life-span in Caenorhabditis elegans. Proc Natl Acad Sci U S A. 1982;79:6603-6607.[Abstract/Free Full Text]
  31. Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning, 2nd ed. Plainview, NY: Cold Spring Harbor Laboratory Press; 1989.
  32. Epstein HF, Shakes DC. Caenorhabditis elegans: Modern Biological Analysis of an Organism. San Diego, CA: Academic Press; 1995.
  33. Kamath RS, Martinez-Campos M, Zipperlen P, Fraser AG, Ahringer J. Effectiveness of specific RNA-mediated interference through ingested double-stranded RNA in Caenorhabditis elegans. Genome Biol. 2000;2:1-10.
  34. Kamath RS, Ahringer J. Genome-wide RNAi screening in Caenorhabditis elegans. Methods. 2003;30:313-321.[Medline]
  35. Libina N, Berman JR, Kenyon C. Tissue-specific activities of C. elegans DAF-16 in the regulation of lifespan. Cell. 2003;115:489-502.[Medline]
  36. Murakami S, Johnson TE. Life extension and stress resistance in Caenorhabditis elegans modulated by the tkr-1 gene [published correction appears in Curr Biol. 1999;9:R791]. Curr Biol. 1998;8:1091-1094.[Medline]
  37. Murakami S, Johnson TE. Erratum: Life extension and stress resistance in Caenorhabditis elegans modulated by the tkr-1 gene. Curr Biol. 1999;9:R791.
  38. Murakami S, Johnson TE. The OLD-1 positive regulator of longevity and stress resistance is under DAF-16 regulation in Caenorhabditis elegans. Curr Biol. 2001;11:1517-1523.[Medline]
  39. Hsu AL, Murphy CT, Kenyon C. Regulation of aging and age-related disease by DAF-16 and heat-shock factor. Science. 2003;300:1142-1145.[Abstract/Free Full Text]
  40. Walker GA, Lithgow GJ. Lifespan extension in C. elegans by a molecular chaperone dependent upon insulin-like signals. Aging Cell. 2003;2:131-139.[Medline]
  41. Parkes TL, Elia AJ, Dickinson D, Hilliker AJ, Phillips JP, Boulianne GL. Extension of Drosophila lifespan by overexpression of human SOD1 in motorneurons. Nat Genet. 1998;19:171-174.[Medline]
  42. Orr WC, Sohal RS. Extension of life-span by overexpression of superoxide dismutase and catalase in Drosophila melanogaster. Science. 1994;263:1128-1130.[Abstract/Free Full Text]
  43. Orr WC, Mockett RJ, Benes JJ, Sohal RS. Effects of overexpression of copper-zinc and manganese superoxide dismutases, catalase, and thioredoxin reductase genes on longevity in Drosophila melanogaster. J Biol Chem. 2003;278:26418-26422.[Abstract/Free Full Text]
  44. Yasuda K, Adachi H, Fujiwara Y, Ishii N. Protein carbonyl accumulation in aging dauer formation-defective (daf) mutants of Caenorhabditis elegans. J Gerontol Biol Sci. 1999;54A:B47-B51 discussion B52–B53.[Abstract]
  45. Murakami S, Johnson TE. A genetic pathway conferring life extension and resistance to UV stress in Caenorhabditis elegans. Genetics. 1996;143:1207-1218.[Abstract]
  46. Dillin A, Hsu AL, Arantes-Oliveira N, et al. Rates of behavior and aging specified by mitochondrial function during development. Science. 2002;298:2398-2401.[Abstract/Free Full Text]
  47. Lee SS, Lee RY, Fraser AG, Kamath RS, Ahringer J, Ruvkun G. A systematic RNAi screen identifies a critical role for mitochondria in C. elegans longevity. Nat Genet. 2003;33:40-48.[Medline]
  48. de Castro E, Hegi de Castro S, Johnson TE. Isolation of long-lived mutants in Caenorhabditis elegans using selection for resistance to juglone. Free Radic Biol Med. 2004;37:139-145.[Medline]
  49. Kops GJ, Dansen TB, Polderman PE, et al. Forkhead transcription factor FOXO3a protects quiescent cells from oxidative stress. Nature. 2002;419:316-321.[Medline]
  50. Polakis PG, Wilson JE. An intact hydrophobic N-terminal sequence is critical for binding of rat brain hexokinase to mitochondria. Arch Biochem Biophys. 1985;236:328-337.[Medline]
  51. Rohde J, Heitman J, Cardenas ME. The TOR kinases link nutrient sensing to cell growth. J Biol Chem. 2001;276:9583-9586.[Abstract/Free Full Text]
  52. Lakowski B, Hekimi S. The genetics of caloric restriction in Caenorhabditis elegans. Proc Natl Acad Sci U S A. 1998;95:13091-13096.[Abstract/Free Full Text]
  53. Kapahi P, Zid BM, Harper T, Koslover D, Sapin V, Benzer S. Regulation of lifespan in Drosophila by modulation of genes in the TOR signaling pathway. Curr Biol. 2004;14:885-890.[Medline]
  54. Kenyon C, Chang J, Gensch E, Rudner A, Tabtiang R. A C. elegans mutant that lives twice as long as wild type. Nature. 1993;366:461-464.[Medline]
  55. Clancy DJ, Gems D, Harshman LG, et al. Extension of life-span by loss of CHICO, a Drosophila insulin receptor substrate protein. Science. 2001;292:104-106.[Abstract/Free Full Text]
  56. Holzenberger M, Dupont J, Ducos B, et al. IGF-1 receptor regulates lifespan and resistance to oxidative stress in mice. Nature. 2003;421:182-187.[Medline]
  57. Bonafe M, Barbieri M, Marchegiani F, et al. Polymorphic variants of insulin-like growth factor I (IGF-I) receptor and phosphoinositide 3-kinase genes affect IGF-I plasma levels and human longevity: cues for an evolutionarily conserved mechanism of life span control. J Clin Endocrinol Metab. 2003;88:3299-3304.[Abstract/Free Full Text]
  58. Apfeld J, Kenyon C. Regulation of lifespan by sensory perception in Caenorhabditis elegans. Nature. 1999;402:804-809.[Medline]
  59. Martin GM, Austad SN, Johnson TE. Genetic analysis of ageing: role of oxidative damage and environmental stresses. Nat Genet. 1996;13:25-34.[Medline]
  60. Kirkwood TB, Austad SN. Why do we age? Nature. 2000;408:233-238.[Medline]
  61. Johnson TE, Henderson S, Murakami S, et al. Longevity genes in the nematode Caenorhabditis elegans also mediate increased resistance to stress and prevent disease. J Inherit Metab Dis. 2002;25:197-206.[Medline]
  62. Lund J, Tedesco P, Duke K, Wang J, Kim SK, Johnson TE. Transcriptional profile of aging in C. elegans. Curr Biol. 2002;12:1566-1573.[Medline]
  63. Van Der Heide LP, Hoekman MF, Smidt MP. The ins and outs of FoxO shuttling: mechanisms of FoxO translocation and transcriptional regulation. Biochem J. 2004;380:297-309.[Medline]
  64. Nasrin N, Ogg S, Cahill CM, et al. DAF-16 recruits the CREB-binding protein coactivator complex to the insulin-like growth factor binding protein 1 promoter in HepG2 cells. Proc Natl Acad Sci U S A. 2000;97:10412-10417.[Abstract/Free Full Text]
  65. Brunet A, Sweeney LB, Sturgill JF, et al. Stress-dependent regulation of FOXO transcription factors by the SIRT1 deacetylase. Science. 2004;303:2011-2015.[Abstract/Free Full Text]
  66. An JH, Blackwell TK. SKN-1 links C. elegans mesendodermal specification to a conserved oxidative stress response. Genes Dev. 2003;17:1882-1893.[Abstract/Free Full Text]
  67. Gottlob K, Majewski N, Kennedy S, Kandel E, Robey RB, Hay N. Inhibition of early apoptotic events by Akt/PKB is dependent on the first committed step of glycolysis and mitochondrial hexokinase. Genes Dev. 2001;15:1406-1418.[Abstract/Free Full Text]
  68. Hinnebusch AG, Natarajan K. Gcn4p, a master regulator of gene expression, is controlled at multiple levels by diverse signals of starvation and stress. Eukaryot Cell. 2002;1:22-32.[Free Full Text]



This article has been cited by other articles:


Home page
 Genome ResHome page
E. D. Smith, M. Tsuchiya, L. A. Fox, N. Dang, D. Hu, E. O. Kerr, E. D. Johnston, B. N. Tchao, D. N. Pak, K. L. Welton, et al.
Quantitative evidence for conserved longevity pathways between divergent eukaryotic species
Genome Res., April 1, 2008; 18(4): 564 - 570.
[Abstract] [Full Text] [PDF]

Home page
 Journals of Gerontology Series A: Biological Sciences and Medical SciencesHome page
I. Lenaerts, G. A. Walker, L. Van Hoorebeke, D. Gems, and J. R. Vanfleteren
Dietary Restriction of Caenorhabditis elegans by Axenic Culture Reflects Nutritional Requirement for Constituents Provided by Metabolically Active Microbes
J. Gerontol. A Biol. Sci. Med. Sci., March 1, 2008; 63(3): 242 - 252.
[Abstract] [Full Text] [PDF]

Home page
 J. Cell Sci.Home page
E. L. Greer and A. Brunet
Signaling networks in aging
J. Cell Sci., February 15, 2008; 121(4): 407 - 412.
[Full Text] [PDF]

Home page
 GeneticsHome page
T. M. Yamawaki, N. Arantes-Oliveira, J. R. Berman, P. Zhang, and C. Kenyon
Distinct Activities of the Germline and Somatic Reproductive Tissues in the Regulation of Caenorhabditis elegans' Longevity
Genetics, January 1, 2008; 178(1): 513 - 526.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Services
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
PubMed
Right arrow PubMed Citation

HOME ARCHIVE SEARCH TABLE OF CONTENTS