

The Journals of Gerontology Series A: Biological Sciences and Medical Sciences 61:107-114 (2006)
© 2006 The Gerontological Society of America
Age-Related Mitochondrial DNA Deletion in Rat Liver Depends on Dietary Fat Unsaturation
José L. Quiles,
Julio J. Ochoa,
M. Carmen Ramirez-Tortosa,
Jesús R. Huertas and
José Mataix
Institute of Nutrition and Food Technology, Departments of 1 Physiology 2 Biochemistry and Molecular Biology, University of Granada, Spain.
Address correspondence to José L. Quiles, PhD, Instituto de Nutrición y Tecnología de Alimentos, C/Ramón y Cajal 4 18071 Granada, Spain. E-mail: jlquiles{at}ugr.es
 |
Abstract
|
|---|
We fed male Wistar rats lifelong on virgin olive (rich in the monounsaturated oleic acid) or sunflower (rich in the polyunsaturated linoleic acid) oil-based diets. At 6 and 24 months, liver mitochondria were analyzed for a mitochondrial DNA (mtDNA) deletion, reactive oxygen species, antioxidants, and ultrastructural alterations. An aging-related increase in the relative amount of the deletion was observed for both dietary groups, being higher in animals fed sunflower oil. Oxidative stress was lower in virgin olive oil-fed animals. Aging led to higher superoxide dismutase, catalase, and glutathione peroxidase activities and increased
-tocopherol and coenzyme Q. Mitochondria from aged animals fed sunflower oil exhibited a lower number of cristae and a higher circularity. Results suggest that the age-related increase of the relative amount of deleted mtDNA depends on fat unsaturation. Moreover, the studied mtDNA deletion was correlated with mitochondrial oxidative stress and ultrastructural alterations.
AGING represents a common phenomenon to all multicellular organisms that is described as an endogenous and progressive decay in the efficacy of physiological processes after the reproductive phase (13). According to the free radical theory, aging is the result of oxidative insult to the organism throughout the life span (4). Some of the damages, mainly those related to DNA, are not entirely repaired and are accumulated, leading to cell death and organism malfunction (5). The main source of reactive oxygen species is mitochondria (6). Mitochondria have their own genome composed of a variable number of copies of identical circular double-stranded DNA localized in the mitochondrial matrix, near the inner mitochondrial membrane, close to the main source of reactive oxygen species. Mitochondrial DNA (mtDNA) is not protected by histones, and it has been traditionally considered to be highly susceptible to oxidative attack (7). From the point of view of aging, oxidative damage to mtDNA is more important than the damage exerted to lipids and proteins. This fact is due to the ability of mtDNA to be disseminated because the division capacity of mitochondria and cells, which amplifies the physiological consequences of the exerted damage. Furthermore, oxidative damage to mtDNA might be even more important than the damage to the nuclear DNA as the entire mitochondrial genome codifies for genes that are really expressed, while the nuclear genome contains a huge amount of nontranscribed sequences (8). Aging is associated with deletions of mtDNA in liver, heart, brain, and skeletal muscle (9) resulting from the combined effects of intense oxidative damage and the low efficiency of mtDNA repair systems (10).
Nutrition has been related to aging, mainly at the level of caloric restriction. Caloric restriction prevents the age-related increase in frequency of mitochondrial deletions in the liver (9), and enhances mean life span in a wide range of species by a reduction in the oxidative stress level (11). However, caloric restriction results in practical and ethical difficulties that make its actual development almost impossible (12). Dietary fat type determines several biochemical parameters at the mitochondrial membrane level (13,14). The importance of dietary fatty acids resides in the fact that mitochondrial membrane adapts its lipid composition to dietary fat (1517). In contrast, adaptations of the electron transport system in relation to dietary fat type have been widely reported (1820). Moreover, oxidative stress is related to biological membrane composition. In that sense, a polyunsaturated fat source will lead to membranes being more prone to oxidation than would a saturated or a monounsaturated fat source. That has been widely demonstrated under a wide range of physiological and pathological situations in animal models and in humans (2125).
The liver is the central metabolic organ of the body; therefore, dietary changes can have a major impact on aging liver and on general health (26). Moreover, the liver is critical in the protection from oxidative damage and plays a major role in the breakdown of potentially toxic lipophilic toxins (27). Although the aging liver appears to preserve its function relatively well (26), several changes have been associated with this organ during the process of aging. Elucidating the nature and mechanisms of these changes in the liver with aging may lead to a better understanding and treatment of hepatic dysfunction. According to that, the present study was designed to investigate the possible effect on a particular deletion at the liver mtDNA level and other aspects (oxidative stress and mitochondrial abnormalities) in liver mitochondria during aging by feeding rats lifelong with two different dietary fat sources. These fats were different in their lipid profile: virgin olive oil, mainly rich in the monounsaturated oleic acid and sunflower oil, mainly rich in the polyunsaturated linoleic acid.
 |
MATERIALS AND METHODS
|
|---|
Experimental Design
Thirty-two male Wistar rats (Rattus norvegicus) initially weighing 8090 g were allocated housed 8 per cage and maintained on a 12-hour light/dark cycle, with free access to food and drinking water. The rats were randomly assigned to two experimental groups and fed from weaning until 24 months of age on a semisynthetic and isoenergetic diet [according to the AIN93 criteria (28)] composed of (in g/100 g of diet): 26.7 casein, 13.53 starch, 45.29 sucrose, 1.0 vitamin mixture, 3.68 mineral mixture, 1.84 cellulose, 0.09 choline, 0.30 methionine, and 8.0 fat. Experimental diets differed only in the dietary fat source: virgin olive oil or sunflower oil (Table 1). Eight rats per group were killed at 6 and 24 months, respectively, from the start of the experiment. Animals were handled according to the guidelines of the Spanish Society for Laboratory Animals, and the experiment was approved by the Ethical Committee of the University of Granada. The rats were killed at the same time of the day to avoid any circadian fluctuation by cervical dislocation followed by decapitation. Blood was collected and plasma isolated. Livers were immediately removed to obtain mitochondrial fraction according to Fleischer and colleagues (29). Liver mitochondrial protein was determined according to Lowry and colleagues (30) using bovine serum albumin as a standard.
Isolation of Total DNA
Total DNA was extracted from 25 mg of frozen liver using the DNeasy Tissue Kit (Qiagen, Valencia, CA). The extract, containing both nuclear DNA and mtDNA, was used for real-time polymerase chain reaction (real-time PCR) analysis without further purification.
Real-Time PCR
Real-time PCR analysis was performed at the Genomic Facility from the Parque Científico de Madrid (Madrid, Spain). Two different regions of the mitochondrial genome were studied, one that is rarely affected by deletions both in humans and in rats (31,32) and another that is absent in the majority of individuals with large-scale deletions (31) and is also included in the so-called common deletion both in humans and in rats (32). The region rarely deleted is within the ND1 gene and the frequently deleted region is in the ND4 gene. Having identified these regions, we designed primers and probes using commercially available software (Primer Express; Applied Biosystems, Foster City, CA). PCR primers and fluorogenic probes for regions of ND1 (forward primer, CGCCCCAACCCTCTCC; reverse primer, GTATGCCTAGGTTGAGGTTGATAAGG; probe, ACTAGCTCTAAGCCTATGAATC) and ND4 (forward primer, CATTTTCCTGATCGAACCCCTCTAT; reverse primer, AGTTTTCCTCGTTGGGTTGTGATAA; probe, TTCCTGTGATGACAATGTT) were synthesized. Concentrations and PCR program for 10-µl assays were as follows: 0.09 µl of 0.25 ng/µl of DNA (separately amplified with the ND1 and ND4 primer/probe combinations). To each sample 4.41 µl of nanopure water, 5 µl of 2 x TaqMan Universal PCR MasterMix, and 0.5 µl of the combination primer/probe (900 nM for the primer and 250 nM for the fluorogenic probes) were added. PCR and fluorescence analysis were performed using the ABI 7900 HT (Weiterstadt, Germany). Amplification conditions were: 10 minutes at 95°C (polymerase activation) followed by 40 cycles with 15 seconds at 95°C (for denaturalization) and 1 minute at 60°C (annealing and extension). Each sample was assayed in triplicate and analyzed with SDS software (ABI) and Microsoft Excel (Redmond, WA). The method used for the real-time PCR quantification was 2
Ct, which has been previously described (33). In this method, the relative amount of the deleted gene R = 2
Ct, where 
Ct is calculated as:
Cts
Ctcal;
Cts is the
Ct for each sample (CtsND1 CtsND4), and
Ctcal is the
Ct for the calibrator (CtcalND1 CtcalND4). Young animals were used as calibrators for changes in relative quantity in old groups. We performed a test (data not shown) to validate the 2
Ct method, which is the calculation of the reaction efficiency (E). Both reactions (that from ND1 and that from ND4) propagated with a very high efficiency (close to 1). When the efficiency between two reactions is similar, Ct does not depend on the dilution series. In that situation, Ct values can be used to measure the input DNA and to quantify the relative amount of ND1 and ND4.
Plasma Biochemical Parameters
Plasma alanine aminotransferase (ALT) and aspartate aminotransferase (AST) activities were measured using Spinreact enzymatic kits (Girona, Spain).
Lipid Peroxidation Status
The ferrous oxidexylenol orange (FOX2) method was used for determining hydroperoxides in mitochondrial membrane. Hydroperoxide levels were assayed according to the principle of the rapid peroxide-mediated oxidation of Fe2+ to Fe3+ under acidic conditions (34) using triphenylphosphine, an agent that avoids artifactual color generation in samples that might contain substantial quantities of loosely available iron. Thiobarbituric acid-reactive substances (TBARS) in mitochondrial membrane were determined according to Orrenius and colleagues (35).
Analysis of Antioxidant Enzyme Activity
Catalase activity was determined following the method described by Aebi (36), by monitoring at 240 nm the H2O2 decomposition as a consequence of the catalytic activity of catalase. Superoxide dismutase (SOD) was determined by the method of Crapo and colleagues (37), on the basis of the inhibition by SOD of the reduction of cytochrome c, as measured by spectrophotometry at 550 nm. Glutathione peroxidase was determined according to Flohé and colleagues (38). That method is based on the instantaneous formation of oxidized glutathione during the reaction catalyzed by glutathione peroxidase. That oxidized glutathione is continually reduced by an excess of glutathione reductase and NADPH present in the cuvette. The subsequent oxidation of NADPH to NADP+ was monitored spectrophotometrically at 340 nm. Tert-butyl hydroperoxide was used as substrate.
Tocopherol and Coenzyme Q Analysis
After extraction with methanol and light petroleum according to the method of Lang and Packer (39), levels of mitochondrial coenzyme Q and
-tocopherol were determined by reversed-phase high-performance liquid chromatography (HPLC) using a Spherisorb S5 ODS1 (Merck, Darmstadt, Germany) column (maintained with an oven at a constant temperature of 22°C) and ethanol/purified water 97:3 (vol/vol) as mobile phase. The HPLC system was a Beckman In-line Diode Array Detector (model 168; Fullerton, CA) connected to a Waters (Milford, MA) 717 Plus Autosampler. Coenzyme Q and
-tocopherol were identified by predetermining the retention times of individual standard. To assay total coenzyme Q as oxidized coenzyme Q, samples were treated with 1,4 benzoquinone (2 mg/ml), and then coenzyme Q was assayed.
Quantitative Determination of Fatty Acids From Mitochondrial Phospholipids
Initial total lipid isolation was performed according to Kolarovic and Fournier (40). Briefly, 200 µg of mitochondrial protein plus 0.5 ml of water were vortexed for 30 seconds with 100 µl of internal standard (0.857 mg/ml of heptadecanoic phospholipids [PL-17:0] dissolved in chloroform). Four milliliters of hexane/2-propanol (3:2) with 25 mg/L of butylated hydroxytoluene (BHT) were added and centrifuged for 10 minutes (4°C) at 1500 g. The organic layer was then removed to another glass tube, and the process was repeated 3 more times with the hydrophilic layer. The organic layer was evaporated to dryness under vacuum. The isolated lipids were dissolved with 200 µl of hexane/methyl-tert-butyl-ether/acetic acid (100:3:0.3, vol/vol/vol). Fatty acid composition of mitochondrial phospholipids was measured by previous separation of lipid classes using aminopropyl columns (Sep-Pak Cartridges; Waters) as described by Agren and colleagues (41). Fifty microliters of PL-17:0 were added to each sample as internal standard. Phospholipid fractions obtained from the columns were evaporated to dryness under vacuum, and 100 µl of chloroform was added to each tube. Fatty acid methyl esters were formed according to the method of Lepage and Roy (42). A gas-liquid chromatograph Model HP-5890 Series II (Hewlett Packard, Palo Alto, CA) equipped with a flame ionization detector was used to analyze fatty acids. Chromatography was performed using a 60-m-long capillary column (32-mm internal diameter and 20-mm thickness) impregnated with Sp 2330 FS (Supelco, Inc., Bellefonte, PA). The injector and the detector were maintained at 250°C and 275°C, respectively; nitrogen was used as carrier gas, and the split ratio was 29:1. Temperature programming (for a total time of 40 minutes) was as follows: initial temperature, 160°C for 5 minutes, 6°C/min to 195°C, 4°C/min to 220°C, 2°C/min to 230°C, hold 12 minutes, 14°C/min to 160°C.
Electron Microscopy Analysis of Isolated Mitochondria
After mitochondrial extraction, 400 µl of extracts was prefixed in 1.5% formaldehyde prepared in 1% cacodylate buffer, pH 7.4, for 2 hours at 4°C. After three washes in cacodylate buffer, extracts were fixed in 1% osmium tetroxide for 60 minutes at 04°C. The samples were dehydrated in graded ethanol and embedded in Epon resin. After overnight incubation at 65°C, ultrathin sections (70 nm) were cut with a diamond knife using an Ultracut Ultramicrotome (Reicher-Jung, Nussloch, Germany) and placed on 200-mesh copper grids. All sections were stained with uranyl acetate, counterstained with lead citrate, and viewed using a Carl Zeiss (Oberkochen, Germany) EM10C electron microscope at 40,000x magnification in the Scientific Instrument Service, University of Granada. Negatives were digitally transformed into positive images. Mitochondrial cristae were counted and expressed as number of cristae per micrometer of mitochondrial contour. The National Institutes of Health (NIH) Image J program was used for the quantification of mitochondrial size, contour, and circularity parameters in isolated mitochondria. All the chemical products and solvents, of highest grade available, were acquired from Sigma (St. Louis, MO) and Merck.
Statistical Analysis
The results represent the mean and the standard error of 8 animals. Previous to any statistical analysis, all variables were checked for normality and homogeneous variance using the KolmogorovSmirnoff and the Levene tests, respectively. When a variable was found not to follow normality, it was log-transformed and reanalyzed. Statistically significant differences (p <.05) were assessed by analysis of variance (ANOVA). To evaluate differences in means across groups, a multiple comparison test adjusted by Bonferroni correction was performed. Data were analyzed using the SPSS/PC statistical software package (SPSS for Windows, 11.0.1, 2001; SPSS, Inc., Chicago, IL).
 |
RESULTS
|
|---|
Relative Increase of the Deleted mtDNA for the ND4 Gene in Old Animals
Young animals were used as calibrator, thus they become the sample with the 1x relative amount, and all other quantities are expressed as an n-fold increase to the calibrator (Figure 1). Old animals fed virgin olive oil showed a 6.5 ± 0.5-fold increase of mtDNA deleted for the ND4 gene; meanwhile, the relative increase for old animals fed sunflower was 10.4 ± 1.5, which represents a 60% higher increase in the group of old animals fed sunflower oil when compared with those fed virgin olive oil.

View larger version (7K):
[in this window]
[in a new window]
|
Figure 1. Relative increase of deleted mitochondrial DNA (mtDNA) in liver (mean ± standard error of the mean; n = 8) of rats fed virgin olive or sunflower oil. *Statistically significant difference between virgin olive oil group and sunflower oil group (p <.05)
|
|
MitochondriaPhospholipid Fatty Acid Content
Concerning saturated fatty acids, no differences were found for this fraction between the dietary treatments (Table 2). A net increase in the amount of this type of fatty acid, individually as well as for total fatty acids, with aging (except for C24:0 in the olive oil group) was found. Monounsaturated fatty acids (MUFA) were higher in animals fed olive oil both at 6 and at 24 months. Aging increased these fatty acids in the virgin olive oil group. In sunflower oil-fed animals, only the total amount of monounsaturated fatty acids was affected by aging, showing a net increase. The n6 polyunsaturated fatty acids (PUFAn6) were higher in animals fed sunflower oil for both periods of time. Aging led to a net increase in all studied PUFAn6 in both dietary groups. Virgin olive oil-fed groups, both individually and as a total, had a higher content of PUFAn3 fatty acids. Aging increased PUFAn3 in both dietary groups. As a consequence of the results of n6 and n3 PUFA, the total PUFA index showed no differences between dietary groups, but aging provoked an enhancement. Something similar was found for total fatty acid content. Finally, concerning the ratio between PUFAn3 and PUFAn6, animals fed sunflower oil had an index seven times higher than that of animals fed virgin olive oil; aging did not modified this index.
View this table:
[in this window]
[in a new window]
|
Table 2. Fatty Acids Content (µg/mg) in Phospholipids of Liver Mitochondrial Membranes From Rats Fed Lifelong Virgin Olive or Sunflower Oil.
|
|
General Parameters and Oxidative Stress Status
Dietary intake did not change significantly among the groups during the experiment (data not shown). Body weight in grams was similar for both diets at the different time points, but old animals reached a higher weight. Liver weight increased with aging, and no differences between dietary treatments were found. AST and ALT activities in plasma were higher for both age groups in the animals fed sunflower oil, and only with this dietary fat did AST and ALT activity increase with age (Table 3).
View this table:
[in this window]
[in a new window]
|
Table 3. General Parameters and Oxidative Stress Markers in Liver Mitochondria From Rats Fed Virgin Olive or Sunflower Oil.
|
|
Concerning mitochondrial lipid peroxidation, hydroperoxides and TBARS showed no differences between dietary treatments in the young animals. Aging increased levels of lipid peroxidation in both groups, although this enhancement was higher for animals fed the sunflower oil-based diet. Concerning antioxidant enzyme activity, SOD, catalase, and glutathione peroxidase showed no differences between diets in the young animals. Aging led to higher activity of SOD and catalase in both groups, but to higher activity of glutathione peroxidase in the sunflower oil-fed group only. In relation to low-molecular-mass antioxidants in liver mitochondria, there were no differences concerning
-tocopherol levels between dietary treatments in the young animals. Aging led to an increased concentration of
-tocopherol in both dietary groups; this increase was higher in animals fed virgin olive oil. For liver mitochondrial coenzyme Q, no differences were found in relation to diet, but aging led to higher levels of this molecule in both groups.
Electron Microscopy Analysis of Isolated Mitochondria
Electron microscopy of isolated mitochondria showed that mitochondria preparations were free of contamination and that all groups exhibited similar purity (Table 4, Figure 2). The size of isolated mitochondria as well as the mitochondrial contour were similar irrespective of diet but were lower in the old groups. The circularity parameter was similar for both dietary groups at 6 months of age. In old animals, circularity was higher in animals fed sunflower oil. The number of cristae per micrometer of mitochondrial contour was lower in animals fed sunflower oil compared to those fed virgin olive oil, both at 6 and 24 months of age. Aging diminished the number of cristae in the sunflower oil-fed group.

View larger version (146K):
[in this window]
[in a new window]
|
Figure 2. Transmission electron micrograph of isolated liver mitochondria of rats fed virgin olive oil or sunflower oil. Magnification: 40,000x
|
|
 |
DISCUSSION
|
|---|
There is numerous evidence from human and animal studies linking mtDNA deletions and aging. One possible molecular explanation for mitochondrial deletions is a slipped-strand mispairing event that could occur during mitochondrial replication (43). Because mitochondrial replication occurs continuously in all cells (44), this mechanism could explain the origin and replication of deletions in somatic cells (45). If the deleted genomes replicate faster than normal genomes, if DNA damage or oxidative stress is higher in old animals, or if repairing mechanisms are less efficient with age, deletions should gradually increase over time. Deletion frequency is affected by age, tissue of origin, species, and presence of some age-related diseases (such as Alzheimer's) and also appears highly variable depending on the laboratory (9). We performed the analysis of a particular deletion by real-time PCR technology. Following that approach, we found an increase of more than 6-fold in the deletion for the old animals fed virgin olive oil, although that increase was 60% higher (more than 10-fold) in old animals fed sunflower oil. The most interesting finding is that the age-related increase in the relative frequency of the studied deletion in rat liver was modulated by dietary fat type. This result shows that the age-related increase in mtDNA deletions can be attenuated. Only caloric restriction has previously demonstrated such a capacity to attenuate the age-related increase in mtDNA deletion frequency (9). These authors related this attenuation with the lower oxidative damage produced by caloric restriction during aging, which additionally could lead to a decrease in the replication cycles, thereby reducing the opportunity for such deletions to become replicated and fixed and/or increased in the population. Following the finding of Kang and colleagues (9) on caloric restriction, we tested the hypothesis that the lower amount of free radicals produced by virgin olive oil is responsible for the lower increase in mtDNA deletion frequency during aging.
It has been well-established that mitochondrial phospholipid fatty acids from body tissues are modulated by the diet (13,16). In this study, the different lipid profiles of diets were properly reflected in liver mitochondrial phospholipids of young and old animals (Tables 1 and 2), and suggest proper adaptation of the rats to dietary fats. These results are noteworthy because any benefit or damage derived from the intake of the two lipid sources is maintained throughout life, providing the opportunity to modulate aging by diet. Also, it is interesting to note the net increase found in all the fatty acids studied with aging, irrespective of dietary fat. As far as we know, this is the first report of this type in mitochondrial phospholipids. However, in relation to blood lipids, evidence suggests that a net increase in the different classes of lipids usually happens (4648). The reasons for lipid accumulation during aging are several, including increased sedentarism, metabolic changes such as those related to a severe age-related impairment of 3-hydroxy-3-methylglutaryl-CoA (HMGCoA) reductase regulation (49), and lower activity of prenyl transferases (50,51). In relation to mitochondrial phospholipids, we have no clue at the moment about the reason of this accumulation with age at the mitochondrial membrane level.
In relation to oxidative stress, it has been described that mitochondrial lipid profiles of animals fed diets rich in PUFAn6 are associated with higher levels of oxidative stress than are those of animals fed virgin olive oil. Examples of such situations are the stress produced by xenobiotics such as doxorubicin (19), the performance of physical exercise (13), or the intake of thermally oxidized (fried) fats (22,24). We have demonstrated, even in aging, that lipid peroxidation is lower in animals fed virgin olive oil (52). In the present study it is confirmed that hydroperoxides and TBARS found in old animals fed virgin olive oil were lower than those in old animals fed sunflower oil (Table 3). Concerning oxidative stress and aging, opposing results have been reported in past years (1). However, after contradictory artifacts are avoided and appropriate biomarkers are used, overall, it seems that free radical damage increases during aging (1,53). Our study agrees with the above-mentioned assumption, which is additionally in accord with the free radical theory of aging of Harman (4). Thus, we found increased levels of damage with aging in both dietary groups, although this increase was higher in animals fed sunflower oil. This higher level of oxidative stress with age may be directly related to the higher lipid content of liver mitochondrial membranes from old animals. However, despite both dietary groups reaching similar levels of total fatty acids, the animals fed sunflower oil had higher oxidative stress figures. That result may be explained by PUFA n6 values being higher in animals fed sunflower oil. Also, as has been stated above, these fatty acids are more prone to be oxidized.
Antioxidant defenses do not decrease with aging; increases with age have been usually described (1). In the present study, higher activities of antioxidant enzymes (Table 3) were found in groups of old animals, irrespective of diet. It has been suggested that low or normal activity of antioxidant enzymes might indicate the existence of a balance between free radical production and antioxidant levels and that an increase in some of them only show an increase in the degree of oxidative stress (54). That explanation would be true in the present study, because the higher antioxidant activity correlates with the increased oxidative stress found in old animals. It is interesting that animals fed virgin olive oil, which had a lower oxidative increase with aging, reached a higher increase in
-tocopherol than those fed sunflower oil. In that sense, the liver appears to accumulate these potent antioxidants at the sites at which they are needed to try to counterbalance oxidative damage (55,56) and apparently, as can be ascertained from the higher increase of
-tocopherol in aged animals fed virgin olive oil and the absence of an increase of glutathione peroxidase in these animals, dietary fat may modulate the final oxidative extent associated with aging. In contrast, the increase in tocopherol and coenzyme Q with age might account only for the net increase in lipids with aging, as these antioxidants are of lipidic nature.
We investigated if changes found at the mtDNA deletion level and oxidative stress status could affect mitochondrial ultrastructure under our experimental conditions. In fact, the lifelong intake of sunflower oil led to worse preserved mitochondrial structure, as suggested by the lower number of cristae per micrometer of mitochondrial contour found in old animals fed sunflower oil compared to young animals fed the same oil; additionally, animals fed virgin olive oil had a higher number of mitochondrial cristae at both age periods. In the same way, mitochondrial circularity (an increase of which represents control loss) was higher in old animals fed sunflower oil compared to those fed virgin olive oil. It deserves to be mentioned that ultrastructural abnormalities at the mitochondrial level are related to several pathologies (57), and here we found a correlation between the mtDNA deleted, the oxidative stress status, and some of these ultrastructural abnormalities.
Summary
Present results confirm the increase in the relative amount of deleted mtDNA in liver with aging and demonstrate that this increase is differentially modulated by the lifelong intake of different dietary fats. In that sense, the use of virgin olive oil led to a lower increase in the deletion than did the intake of the more polyunsaturated sunflower oil. In contrast, under our experimental conditions, the increase in the relative amount of studied mtDNA deletion could be correlated with mitochondrial oxidative stress status and ultrastructural alterations.
 |
Acknowledgments
|
|---|
We are grateful for financial support to the Spanish Ministry of Science and Technology (grant 1FD97-0457-c02-01). Dr. José L. Quiles, Dr. Julio J. Ochoa, and Dr. Carmen Ramirez-Tortosa are supported by a "Ramón y Cajal" contract from the Spanish Ministry of Science and Technology and the University of Granada.
We are also grateful to Dr. Ricardo Ramos (Genomic Facility of the Parque Científico de Madrid) for his assistance with the real-time PCR analyses and to Dr. Concepción Hernandez and Dr. David Porcel (Scientific Instrument Service of the University of Granada) for their assistance with the electron microscopy analyses.
 |
Footnotes
|
|---|
Decision Editor: James R. Smith, PhD
Received January 6, 2005
Accepted July 15, 2005
 |
References
|
|---|
- Halliwell B, Gutteridge JMC. Free Radicals in Biology and Medicine, 3rd ed. Oxford, U.K.: Oxford University Press; 1999.
- Camougrand N, Rigoulet M. Aging and oxidative stress: studies of some genes involved both in aging and in response to oxidative stress. Respir Physiol. 2001;128:393-401.[Medline]
- Barja G. Rate of generation of oxidative stress-related damage and animal longevity. Free Radic Biol Med. 2002;33:1167-1172.[Medline]
- Harman D. The free radical theory of aging. Antioxid Redox Signal. 2003;5:557-561.[Medline]
- Sohal RS, Mockett RJ, Orr WC. Mechanisms of aging: an appraisal of the oxidative stress hypothesis. Free Radic Biol Med. 2002;33:575-586.[Medline]
- Lenaz G. Role of mitochondria in oxidative stress and ageing. Biochim Biophys Acta. 1998;1366:63-67.
- Richter C, Park JW, Ames BN. Normal oxidative damage to mitochondrial and nuclear DNA is extensive. Proc Natl Acad Sci U S A. 1988;85:6465-6467.[Abstract/Free Full Text]
- Van Remmen H, Richardson A. Oxidative damage to mitochondria and aging. Exp Gerontol. 2001;36:957-968.[Medline]
- Kang CM, Kristal BS, Yu BP. Age-related mitochondrial DNA deletions: effect of dietary restriction. Free Radic Biol Med. 1998;24:148-154.[Medline]
- Barazzoni R, Short KR, Nair S. Effects of aging on mitochondrial DNA copy number and cytochrome c oxidase gene expression in rat skeletal muscle, liver and heart. J Biol Chem. 2000;275:3343-3347.[Abstract/Free Full Text]
- Masoro EJ. Caloric restriction and aging: an update. Exp Gerontol. 2000;35:299-305.[Medline]
- Finkel T, Holbrook NJ. Oxidants, oxidative stress and the biology of ageing. Nature. 2000;408:239-247.[Medline]
- Mataix J, Quiles JL, Huertas JR, Battino M, Mañas M. Tissue specific interactions of exercise, dietary fatty acids, and vitamin E in lipid peroxidation. Free Radic Biol Med. 1998;24:511-521.[Medline]
- Quiles JL, Ramírez-Tortosa MC, Huertas JR, et al. Olive oil supplemented with vitamin E affects mitochondrial coenzyme Q levels in liver of rats after an oxidative stress induced by adriamycin. Biofactors. 1999;9:331-336.[Medline]
- Huertas JR, Battino M, Lenaz G, Mataix FJ. Changes in mitochondrial and microsomal rat liver coenzyme Q9 and Q10 content induced by dietary fat and endogenous lipid peroxidation. FEBS Lett. 1991;287:89-92.[Medline]
- Quiles JL, Huertas JR, Mañas M, Battino M, Mataix J. Physical exercise affects the lipid profile of mitochondrial membranes in rats fed with virgin olive oil or sunflower oil. Br J Nutr. 1999;81:21-24.[Medline]
- Ochoa-Herrera JJ, Huertas JR, Quiles JL, Mataix J. Dietary oils high in oleic acid; but with different non-glyceride contents; have different effects on lipid profiles and peroxidation in rabbit hepatic mitochondria. J Nutr Biochem. 2001;12:357-364.[Medline]
- Battino M, Ferreiro MS, Littarru G, et al. Structural damages induced by peroxidation could account for functional impairment of heavy synaptic mitochondria. Free Radic Res. 2002;36:479-484.[Medline]
- Huertas JR, Battino M, Mataix J, Lenaz G. Cytochrome oxidase induction after oxidative stress induced by adriamycin in liver of rats fed with dietary olive oil. Biochem Biophys Res Commun. 1991;181:375-382.[Medline]
- Quiles JL, Huertas JR, Mañas M, Ochoa JJ, Battino M, Mataix J. Dietary fat type and regular exercise affect mitochondrial composition and function depending on specific tissue in rat. J Bioenerg Biomembr. 2001;33:127-143.[Medline]
- Quiles JL, Ramírez-Tortosa MC, Ibáñez S, et al. Vitamin E supplementation increases the stability and the in vivo antioxidant capacity of refined olive oil. Free Radic Res. 1999;31:129-135.[Medline]
- Quiles JL, Huertas JR, Battino M, et al. The intake of fried virgin olive or sunflower oils differentially induces oxidative stress in rat liver microsomes. Br J Nutr. 2002;88:57-65.[Medline]
- Ramírez-Tortosa MC, López-Pedrosa JM, Suarez A, Ros E, Mataix J, Gil A. Olive oil and fish oil enriched diets modify plasma lipids and susceptibility of low density lipoprotein to oxidative modification in free-living male patients with peripheral vascular disease: the Spanish Nutrition Study. Br J Nutr. 1999;82:31-39.[Medline]
- Battino M, Quiles JL, Huertas JR, et al. Feeding fried oil changes antioxidant and fatty acid pattern of rat and affects rat liver mitochondrial respiratory chain components. J Bioenerg Biomembr. 2002;34:127-134.[Medline]
- Ochoa JJ, Quiles JL, Ramirez-Tortosa MC, Mataix J, Huertas JR. Dietary oils high in oleic acid but with different unsaponifiable fraction contents have different effects in lipid profile and peroxidation in rabbit-LDL. Nutrition. 2002;18:60-65.[Medline]
- Anantharaju A, Feller A, Chedid A. Aging liver. Gerontology. 2002;48:343-353.[Medline]
- Thomas RP, Guigneaux M, Wood T, Evers BM. Age-associated changes in gene expression patterns in the liver. J Gastrointest Surg. 2002;6:445-454.[Medline]
- Reeves PG. Components of the AIN-93 diets as improvements in the AIN-76A diet. J Nutr. 1997;127:838S-841S.
- Fleischer S, McIntire IO, Vidal JC. Large-scale preparation of rat liver mitochondria in high yield. Methods Enzymol. 1979;55:32-39.[Medline]
- Lowry OH, Rosebrough HJ, Farr AL, Randall RJ. Protein measurement with folin phenol reagent. J Biol Chem. 1951;193:265-275.[Free Full Text]
- He L, Chinnery PF, Durham SE, et al. Detection and quantification of mitochondrial DNA deletions in individual cells by real-time PCR. Nucleic Acids Res. 2002;30:e68.[Abstract/Free Full Text]
- Van Tuyle GC, Gudikote JP, Hurt VR, Miller BB, Moore CA. Multiple, large deletions in rat mitochondrial DNA: evidence for a major hot spot. Mutat Res. 1996;349:95-107.[Medline]
- Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(-Delta Delta C) method. Methods. 2001;25:402-408.[Medline]
- Nourooz-Zadeh J, Tajaddini-Sarmadi J, Wolff S. Measurement of plasma hydroperoxide concentrations by the ferrous oxidation-xylenol orange assay in conjunction with triphenylphosphine. Anal Biochem. 1994;220:403-409.[Medline]
- Orrenius S, Moldeus P, Theor H, Hogberg J. Microsomes and Drugs Oxidations. New York: Pergamon; 1977.
- Aebi H. Catalase in vitro. Methods Enzymol. 1984;150:121-127.
- Crapo JD, McCord JM, Fridovich I. Preparation and assay of superoxide dismutases. Methods Enzymol. 1978;53:382-393.[Medline]
- Flohé L, Gunzler WA. Assays of glutathione peroxidase. Methods Enzymol. 1984;105:114-121.[Medline]
- Lang JK, Packer L. Quantitative determination of vitamin E and oxidised and reduced CoQ by high-performance liquid chromatography with in-line ultraviolet and electrochemical detection. J Chromatogr. 1987;385:109-117.[Medline]
- Kolarovic L, Fournier NC. A comparison of extraction methods for the isolation of phospholipids from biological sources. Anal Biochem. 1986;156:244-250.[Medline]
- Agren JJ, Julkunen A, Penttila I. Rapid separation of serum lipids for fatty acid analysis by a single aminopropyl column. J Lipid Res. 1992;33:1871-1876.[Abstract]
- Lepage G, Roy CC. Direct transesterification of all classes of lipids in one-step reaction. J Lipid Res. 1986;27:114-120.[Abstract]
- Shoffner JM, Lott MT, Voljavec AS, Soueidan SA, Costigan DA, Wallace DC. Spontaneous Kearns-Sayre/chronic external ophthalmoplegia plus syndrome associated with a mitochondrial DNA deletion: a slip-replication model and metabolic therapy. Proc Natl Acad Sci U S A. 1989;86:7952-7956.[Abstract/Free Full Text]
- Gross NJ, Getz GS, Rabinowitz M. Apparent turnover of mitochondrial deoxyribonucleic acid and mitochondrial phospholipids in the tissues of the rat. J Biol Chem. 1969;244:1552-1562.[Abstract/Free Full Text]
- Cortopassi GA, Shibata D, Soong NW, Arnheim N. A pattern of accumulation of a somatic deletion of mitochondrial DNA in aging human tissues. Proc Natl Acad Sci U S A. 1992;89:7370-7374.[Abstract/Free Full Text]
- Toth MJ, Tchernof A. Lipid metabolism in the elderly. Eur J Clin Nutr. 2000;54:S121-S125.
- Hardy RW, Meckling-Gill KA, Williford J, Desmond RA, Wei H. Energy restriction reduces long-chain saturated fatty acids associated with plasma lipids in aging male rats. J Nutr. 2002;132:3172-3177.[Abstract/Free Full Text]
- Asha Devi S, Prathima S, Subramanyam MVV. Dietary vitamin E and physical exercise: I. Altered endurance capacity and plasma lipid profile in ageing rats. Exp Gerontol. 2003;38:285-290.[Medline]
- Marino M, Pallottini V, D'Eramo C, Cavallini G, Bergamini E, Trentalance A. Age-related changes of colesterol and dolichol biosíntesis in rat liver. Mech Ageing Dev. 2002;123:1183-1189.[Medline]
- Stahlberg D, Angelin B, Einarsson K. Age related changes in the metabolism of cholesterol in rat liver microsomes. Lipids. 1991;26:349-352.[Medline]
- Thelin A, Rundquist M, Ericsson J, Swiezewska E, Dallner G. Age-dependent changes in rat liver prenyl-transferases. Mech Ageing Dev. 1994;76:165-176.[Medline]
- Ochoa JJ, Quiles JL, Ibáñez S, et al. Aging-related oxidative stress depends on dietary lipid source in rat postmitotic tissues. J Bioenerg Biomembr. 2003;35:267-275.[Medline]
- Chevanne M, Caldini R, Tombaccini D, Mocali A, Gori G, Paoletti F. Comparative levels of DNA breaks and sensitivity to oxidative stress in aged and senescent human fibroblasts: a distinctive pattern for centenarians. Biogerontology. 2003;4:97-104.[Medline]
- Aejmelaeus RT, Holm P, Kaukinen U, et al. Age-related changes in the peroxyl radical scavenging capacity of human plasma. Free Radic Biol Med. 1997;23:69-75.[Medline]
- Van der Loo B, Labugger R, Aebischer CP, et al. Cardiovascular aging is associated with vitamin E increase. Circulation. 2002;105:1635-1638.[Abstract/Free Full Text]
- Quiles JL, Martínez E, Ibáñez S, et al. Ageing-related tissue-specific alterations in mitochondrial composition and function are modulated by dietary fat type in the rat. J Bioenerg Biomembr. 2002;34:517-524.[Medline]
- Sanyal AJ, Campbell-Sargent C, Mirshahi F, et al. Nonalcoholic steatohepatitis: association of insulin resistance and mitochondrial abnormalities. Gastroenterology. 2001;120:1183-1192.[Medline]
This article has been cited by other articles:

|
 |

|
 |
 
J. J. Ochoa, J. L. Quiles, M. Lopez-Frias, J. R. Huertas, and J. Mataix
Effect of Lifelong Coenzyme Q10 Supplementation on Age-Related Oxidative Stress and Mitochondrial Function in Liver and Skeletal Muscle of Rats Fed on a Polyunsaturated Fatty Acid (PUFA)-Rich Diet
J. Gerontol. A Biol. Sci. Med. Sci.,
November 1, 2007;
62(11):
1211 - 1218.
[Abstract]
[Full Text]
[PDF]
|
 |
|